Description :
From Genome Similarity Track
Location :
contig_95:50991- 54346
Transcript NameFunction/comments
g10877.t1hypothetical protein

Sequence
3355 bases(100 bases per row)
GCAGTGACCGAGCTGCCATTCCCTGCTTCAAAAAAGGGGATGCAGTCTTTCCTCGGTGCGCTGAATTATTACAGTCGATTCATCCAGGACTTCGCAGTGT
ATGGAGCAGCTTTGTACCAGTTGAAGGACGAAGACTTCACGCCTAGTGGCAGCCTCTCGGCGGCCAACGAAGCTTCGCGCGCTCCAACAGAAGGTTGCAG
AGGCACCGATCCTCCGGCACTTTGACCGAGACAAGGAGGTGCATGTCACGTTATTCGCGAATGAGTGGGCATTGAGCTCCACTTTGATGCAATACCATGA
TGACAAGCTGCACCCGGTTCGATTTTGTGGCCGAGTCCTCAAGGACGCCGAGATGAACTACCACCCGGCCGAGAAGGAGGTCTTAGCGCTACTGCTGGTG
TTGAAAGTGTGCTACTCCCAGTTGGTGGGTCGGACCATCCACGTCTATACGCGTTTTTCGACGCTCGAATGGGTGCACAAATCCAAGACACTGTTCGGTC
GAGCGACCCACTTTGCGGTTATGTTGTCCCCGTGGCACCTGGTGGTCAACCGAGTCAAGGAACGCGATTGTACGTTTGCTCAGCTTCTCCAAGCTGGCCT
CACAAGCTTCGTGGAGTTGGAAGACTCGTTGGCCCCAGTTACACCGCCGACGAAAGGGTCACCTACTGCTCGTATGGACCCCCACTTGCTTTATGCCTGC
CTACCGAGGTCCTATACCGGATTTGTGATGTCGTTCGATGGTTCGGCCAAGACCGAAAAGAACGGTGGATATGGCAGTTGCTCGTGGATTTTGTGGAAAT
TACCAGAATGGACTGTAGTGACGGCTGCGAGTGCTTATCTCGAGACCACCACGGTAAACCTCGCTGAGTATGCTGGAATGAACAACGGCGTCTCAGCTGC
GCTCGAACATGGAGCCGAGGATTTAGTCATCGTGGGAGACTCGAGACTCGCAATCCAGCAGTCCCTAGGGGTGATGGCATGTCGAAAGGAGTCTCTGATG
GTTCAACTGAATCGTCACCGAGAACTCACGACCAAGCTGCGGTCGGTGAAGTACTTGCACGTGGTCCGAGAATTCAACGCTGCAGCAGATTCGTTGGCAA
GCGAGGCTCTCAGCAGCAAAGAATCCAGCGTAGCTTCGACCGAGGCTAGGAAATTAGAATTGGTCGAGCTGAACCGGATCGGAGAGGTCATCTATGAACC
CTCAGTACAGACCACGGCCGAAGAGAAACCGACAGTCAGCTTCGCCCGAGCCCAAGTAGCCCGTGGAATCTCCCGCGACAGATCTTTTTTCGACTTTGTG
CGGGACGAACCCGACTACCTAACTGCAACAACCAGACACCAAGCAAAAGCGAGGAAGAAACGAGTCCAGTTTGCAGATGAAACGTCGGTGATAGAGCCGA
ATGGTACAGCTGAGCGAGACGAAGCGAATGGTGTGACCACCGAAGCTCAGAGTGAGCTGAGAGCCGAGCAATCGAGCAACGAGGTAGACCCTGGCGCTCC
AAACGCAGAAGACGTTGACCCTGTGGTTATACAGGAAGAGCGCCGGAGACGAATCTCCGCCGCCCAGGATGAAGAGCTGAGATGGTCGAACCTAAAAGCG
GTCCTCCGAGGCAAGGAAACAGACCTCAGCTACAGAGCAGCCAGAGACGCTTGGAAGATGGCCGACAAGTTCGTGCTTAGCGAGGATGGTGTACTGTATT
TTCTTGGAACGAACCGTCGGTGGGGCAACGAACGCCGAGAGGAGACAACGATGCGTCTAGTGGTGCCCACAACGATGATTCAGGAAGTACTACGGAGTTG
CCACGACTCGTTGGAAGGTGGCCACCAAGGTATCGGTCGAACGTACCACCGAGTCAAATCAGACTATTTTTGGATTGGACAGACGCCGAACGACACGTCA
AGTCCTGCCCCGACTGTAGTTCGAGCAAAAGTCGACCACAGTTCCGAGGCTATTCGCCAGGAAATGTCTTAGCAGAGCGACCGTTCCAGATGGTGTCGAT
GGATTTCGTCATACCGTTACCGAAGTCTCGTCGGGCAACTCAGCCCTACTACTGTTCCAGTGCGCGTTCACAGGATTCGTCATGGGTAAAGCTATGTCAG
ACACTACCGCTCTGAGGGTCGCACAGGCTTTCGAGGAATGCGTGTACCGAAGATTCGGAGCACCAACTCTGATCCGACATGACCGAGACCCTCGCTTCAT
GAGCGAGGTGTTCCAGGCCTTTGCAGAAATGATGCAGTCTCGGTCAAGAGCGACCCTGAGCTATCGGCCGCAGGCGAACGGACAGCAAGAGAGGTCGGTG
AAGACGGTCATGCAATCGGTGCGGGTGTACGCAGAAGACCCGCTGCAGCAAGACTGGGACGAGATCGCGGAGCGATTGATCTTCGCTATCAACAACTCTC
AAGATGGCACCCGGAAGGACACTCCGTTTTACCTAGTTCATGGGTGGGACGCACAATCCACGCTGCGAGCGATGTCGTCGTCACTCAAACGAGGATTCGG
AGGCCAGACTGACGCATTGGCATGGCGCCGAGAAGTGAACCGGCAACAGGAAATCTCGTGGAAAATGGCAATGGAGTACCAAAGTGTCGAGAAAGCTCGG
AGGGCGAGAGAACACAATGAGTCGCTGGAGCGACGTGAGAGAGCTGCAGTACCGAATGTCGATGAAAACGAGACTTCTGACGAGTCACAGGTGGAGACGG
GGGCAACATCTGACCCCACTGTCGAAGGACCGAGGTCTCTGTTCCAACCCGGAAGCAGAGTTTGGTTGTATATGGAACGAGTCAAGCCAGGGTTGACCAA
GAAACTCGCCCACCGATGGCATGGACCATTCAGGATCAAGAAAAAGATCGAAGAGTTTGCGTACGAGTTGGAATTGCCAGACCGAAGTGGGTATAGGTTC
TACCCGGTGGTACACGTGTCCCGACTCAAGGCCGTCAACGAATTTGGAGACCGACCGAAGAGTCGGTTAGCACCTGAAGTGACCGAGGATACGAGACTGG
ACTTCGACGAGGAGTTGTTGCCTGAAGATAGCTGGGAGCCAGACCAGCTCGCTGGCGAATATGAGGTAGAAGCCATCCTCGATGACCGATCCCCGCTGTC
GACGGGCACTAGCCGCGCTGTCCGAGAGTTCAAAGTGAAGTGGATTGGGTATGATGACCCACGTGGGAGCCTGCCTCAAATTTATCATGTGGCGGGCTAC
TTTATGATTATCTGCGGACTCGGCGCAGCGAACGACGATTGCAGATGGTTCAAGTGCTGACGAGAACTAATCTGGAGAGCTACCGAGAGTTGAACTGTCT
ACGGGGGTGATACAGCCCGTAGCAACAGATGAAATTTGCTACTGTATCAAAATTG