Description :
From Genome Similarity Track
Location :
Scaffold_121:50989- 52975
Transcript NameFunction/comments
Physo_142742hypothetical protein
Physo_142743TKL family protein kinase

Sequence
1986 bases(100 bases per row)
TTGCCACCACAACACAACCAAGCGCAATAGGAGTCAATGGCCACAAAGTTCGTCGCCCACGGGACTTGTACGGGCCATACTGTAAATCTGTGGGCGATAA
TTCTCTGTCGAAATAGCAGAACGGGGCATCACGCTGCCGCAAAGTTGATTTTGCACATTCGAATGCCCGATTCGTTGGAGGATTGCCGTCACCAAGCAAC
CGTGCGGTGAACGCCCACTCAGAGCTGAGAATCTTGTGCACATCAACTTCAAACAGCACACTGCAGAAGGAATTATCGAGTGGCCAGACCCTAAATAAGC
CCATGATCTCGTCCAACGTGGTTGGATCCATCGTGCTGAGCTTTTCCACTAGCAGCCGCTTCACAAAGTGTGGAGGTTCCGCTAGCTCGTATCTTCTCGG
GTTGTCTGGATGCGGTGCATACAGGACCATCTCAGATTCCAAATCCTGCAGAAGACGCCGCGCGATGCCGGCATCGTTGAACTGCCCAACCATCTTTTCG
ATATCGTGCTGCCGTTGGTAGACGAAATCTTGGTCGCTGGCCAGATACTCGCGCACAATGCCACCAAAGGTAATAAAACGCACCTCGACTTCGTCCTGAT
TTAACGCTTTGGGACTCTCGTCGCCTCCGAGAACGGAGAGATGGAGCGCTTTTGCGGCGGTTTGAAGCTCCCGAAGATCCCACAGCGGCATGAACAGTTT
TGGCCGGTATTGGCTCTTCTTGATGTGGTCAAACCACGATTTGTCTGAGCTTGTGAAGCACACCGCTCGAGCGCTCGCTGCAGCGATTTTAGGCGAGCCA
TTGTACAGGTGAATCACGTTGGACTTCGCTTCTTTCTCGGCCTTCTCAATCAAGTTGCCTATCGCCAGTGAGTTGCTTGTGGCAGCTACCACCCTGTCAC
CTTTCCAGACGACCACCTCCTTCAGTACGGACGCGTTGTTTTCTTTTGCGAACGATATCGTGATGATTGAAGTAGCCTCGTTCTCGGCTCTGTAGCGCAG
GAAGAAGTAAGCGTAGAATAAGGACTTGCCGATGCCTGCATGGTTACATGTGGTAAGCGTATTCTAACGTGTAAGAAGTGCTGACCACCCAACGTGATCT
TACCTGGATTGTCAGTCACTGTGACCACCTTTGCCCTCTTTGAATTGAGCATTCGAGTAATGAGGTTGTAGTAATGGGGGTAGCACGCGCGCACGTAGAA
CCTCAGCTCCTCGAACTCGTACTGCATGGGCAACTCCCGCGGGAACGCCAACGTCATGCAATCGACCCACTTGGGGTCAGACCTGGCAGCTTCAGGCGTC
TCCATCCCGTTGGTTCTTTCTGCAGTAAGTAGTAGTGAGTCTGATTTTACGAACAAATTTTTTTCTCTGAAAAAGTATTTACCCCCCCCCCCCCCCAAAA
AAAAAAAAAAAGTTCGGAAGCAACGAGTGGGTTGGTTCAAGTTTACTTTTTGCGTGAGTCTTTGTGGGCCGTTAATTGCTATCTCTTGCGACGAAGCACT
TGTATCAGTGTGACCCTCCCAAAAACCTGTGGACCGCACTCGGCAAGTGAGACCAACGAAAATTAGCCTTGGTGGGTGACAGTGTTTACCGGTGGAGTCC
AACGACCTCGTCGACTCTTGAACCGCGGCAAGAGCTCGATACTAGCACCTCCACTTTCATTTTCGCCCCCAACCGCACAATGTCAAGCTCTGTCTCGTTC
ACTGGGTCGTCCTCGTCCAGCGACACCAACAGCTTCAACATGGGACTCCTCGTGCCGATCATCGGTATAGCCGTTCTGCTTCTGCTCGGCGGAGCGTGTT
GCTGCTGGATGCATCGGCAGTGGTAGAAGTCTGGACGGACCTACGAAGACCGTCGAGCAGTGGCCGTCTCGTTCTCTCAGCTCCACCGGTCTAACGACAT
GACCGAGCTCGTGACCCCCACGACGATCCAAACCGCGTACGAACCGAGTGGTGAAGACACGGCACACCGGCGCGTGGCTCGGATGC