Description :
From Genome Similarity Track
Location :
Scaffold_10:509764- 511261
Transcript NameFunction/comments
Physo_340843Hypothetical protein

Sequence
1497 bases(100 bases per row)
CGACCTGATCACCGGACCCAACATTACCGCGTTGATGGCCGATCGCCCCTGGCAGGTGCTGCAGAACCCGGCCAACCCGTTGACTTTCGATCTGGCACTC
CATCGAGGCGCCGGCACTCGATCGGGTCGGATCGCCACCGCCTACCTTCAACTCGAGGCGCAGCATCGCCAGGCCTTCTGGGAAACCACTCTTTATCTCC
CGATCACGGCCGCGCAGCGTCGGGACCCGATCGTTGAGCAATATCATCGCGATCGCAGAGCCCAACGGATCCGTCTCGGTGATTGGTGGCGCCGACTCCT
CGACGCGATGTTGCCCATGATGCGAGAGATGTGGGCAGACGTCGATCTGCTGCTGGACCCGTTCTTCTTGCAGATCCCGGTGCGACAGCGGGACGCTGTG
ACCTGGTAACTCGGTGTGGTGTCTCGCGCTGCGATTGCTGGCGACCCCACCCAGCACCACGGTGAACCGACCGACCTCCGAACGGCTCTGATCGAGGCCG
ACACCCATGACCCCTGGCGGAACCAGTATCGCGACCACCCCCAGGACCATCACGCTCAACGGATCCCGCGCCTCCGCAACAAGTTCAACCCCAACGTCGG
CGCCCAGTACCAGCGATGACATGATCGCCGTCTCTGCGATCGACTTCCGTAAGTAGCGAGCCAGTCGACCATTACACCCTCAGAGTCGGAGTGACCCGGA
GGCCGATCTTCCATACGCGTAACGCGACATATTCAGATTAATCCATTCCATCGTAACAATCAGCATTCTTCCTCGATGTCCCACTGTCCCTGTCAATCCA
TTCGTTGCTAGCTCGATCGGCCAGGATCCGTCCTCATGCACTCGCTCCATAACCATCCTATCTGCACTCACGTACCCACACTCATTCATATACAACCCCT
TCCTCCGATCTACGGCCTCCCCGTCGATCCGTCATCCATCTCGCTCACCAAGGCGACCATGTCCGTGATCTTCTCCACTTCGTACTCGTTCGAGTCTCGA
TCTGAGGCCCAGCTGTCCTCCGGAAGTAAGACTTCGTCGAAATCAAGTCGATCTGTTTTGTCCACCGTGAGCGCGATCTGCGGTCGATCGGGGAAGTCTC
TGACCAACTTCAGCTTCGAGACATGCACGATCGGGAACAGGTGATAGTCTGTACCAGCGATCTGAAGTTTCATCGTGTACTCGTTCACCTTCTCCGCAAC
GCGGAACGGGCCGTGCCACAGGTGAGCCAGCTTCCGGGCATACCCCTCTCTCACACGATCCAGGTACAGCCACACCTGAGATCCAGCCTCGATCGAGTGT
GGTCGAACTTCTTCATTGTGTCGATCGGCCCGATCCGCGATCGCCTCGCGTAGGCGAACATTCACCTGACTTCGTGCCTGATCGTAGTGCCTCTGGATCC
GATAACGCCACCGTCGAGGATTCCGATCCCGAGTCCGAGTACTACCCAAAGGTATCGTCGCCTCAAGCGTCGATCGAGGATCCCAACCATGCACCAA