Description :
From Genome Similarity Track
Location :
Scaffold_2:50966- 52706
Transcript NameFunction/comments
Physo_480602Hypothetical protein

Sequence
1740 bases(100 bases per row)
TACAGCACCAAGCTGTGGGATGCTCGGCCCTCCAAGTACTCGCAGAACGTCATCAAGAAGGTCTGCGTCTTCATCTTCGTCCTGACAGTGTGCGAGGAGG
TGGCAAGCTACGCCGTCAACCAGTCGCTCAAGAACTTCTTCCAGCGGCTGGGGTGGTCCAACAAGGGCTCCAACTCCATGAAGCTCACCTACGACTCGCT
GAGTCAGTTCGCATGCATCCCTGCGGGCTACATCTCGGATGAATTTCTAGGCAAGTTCAAGACGCTGCTTGGTGCTGCGTCTTCCAGCTCGGTTGGCTTC
GTGCTCATCTCGCTCGCAGCTTTGCCGTCCATCCGTGCCACACAGTCGTTGAGCAAGGCGCTATTCTGCGTTGGTCTCTTCGGTGGCGTTGCGCTAAACC
AAGTGTGCCTTCGAGCTCTGACGGTCTCATTTGGTGGCGACCAATTCTCGAGCACGTCGCCTCCGGACGAGCGCGCAAGCTTCTTCAGCCTGAACTTCTG
GGCTTCCCGGATCGGCATCTCCTTCAGCTATGCGGTGTTTCCCTCGTTGGCCATCCACGGCTTCGGCGCCATCCCCGCTGACTATGGGTTCGTGGCTGTG
TACCTCGTCGGCCTCCTCGTGTTGCTGATCTTCGTCGGAGTCATGCTGTTCACTCGCAAGCGCTACGTGGACGTGCCACCCACGAGAAGCGCTCTCGGAA
GTGTGATCCGTGTCGTTGTTCGTCGCGCCAAGACCAACTTCCAGGCAAGGATGATTTTACTGGGCACAGTCATGTACCTATCTGCATTTCTGCTTAACTT
CCCAGCGGCATTCTTGGCGGATCATGGGGAAATCGGCCACAACATTTCCTACGCGTGTGGAGTCTTGACGGTCGTCGCCACGATCATCTACGTCTACTTC
GCTAGGGATTCCTCGTTCATCGAAGGTGCCACAGACGCTCTCGGAGTCGAACTGGATCCCGAAACGATTCGAGGCATGAAGCAAGTCATCCGCGTCCTGC
CTTTTAACGCCTTCAACATGATGTGGTGGGTCTGCCAGAACCAGCGCGGCAACAACCAAACAATTATCCAGCAAACGGATGTGCGTCTCGGCAGCTCCCC
CGACGCGAGTCAAATTCCAGGACCCACCGTCCAGATTTTCAATCCCTTCTCGGGTCTGCTCTTCGTGCCGCTCTTGGACAAGCTGATCTACCCTCTGTAC
GAGAAATTCGCTGGCAAACCACCGAGTCGATATGGAAAGGTGCTTGCTGGTTACATTGTGGCGATCATCGCGATGGTCTGGACTGGCTGCTTCGAGATCA
TCCGGCGCAACTCGCCACTGCTGACGTACGTGGACGCGAATGGAGATACCCAGTACATCTATAATGACGATGGGGGCCAACCGATGAGCGACATCCCGTG
GTGGACGGCTGTCCCCCAGTACTGCTGGGTGTCCTTGGCAACGGTACTCATCCAGATCTCGACCTACAACATTGGCTACACGGAGGTCCCGCTGAGCTTG
TGCGGAATGTCTATCGCTCTCGGATTCTTCATGAACTCCATGGGCAGCACACTGCTCTCCGTGTTTGTGCTGCTGTTTGGCAAGTACATCCCCACGGACT
TGAACGACGGCCACATGGAGTATCTTTACTTCACGCTGGCTGCTGTCATGGCGGTCAATACCTTCTTCTACGTTGTAGTGATGCGAGAGATGCACTTCGC
AATGATCCCACCGGTCACCGCAGACAAGGGGCTAACGGAG