Description :
From Genome Similarity Track
Location :
Scaffold_18:509557- 511005
Transcript NameFunction/comments
Phyca_LT1534110442flagellar biosynthesis regulator FlhF

Sequence
1448 bases(100 bases per row)
atctttcttctggggtggacgattccgccgagtaccgcaggagtttcagcttccagactgttctgtggcgacactgtggataaagtggcagtgtggaaac
gcgacaaagaagatccctccactgcgtatgctcgatggtctggacatgccgaatagaaaaggcttagtgacattcgctaccttatgagcagtgtgaggcc
gaagaagtacgacgtatcggtatgtggcgagctcgtcagaatgtagaagaagctgtgaagacattctccgcatgtgcaagcgtcgttgctgtacctcaaa
gaaccacaagcgacgtcaaggtcagctcagctggaaaacggtggtggcgttgatgcgcagacgccggaagtagtagtggatgattggttattttttgtgt
taaccacttcacggcattggtagaaataaggttattttcatgtcctgcgtttgtcctgcaaatccgtctaacaagcattttcactgtcagttcggtgagg
cgggtgcggctgaaacatgtggctctaggttaagctacaaagtcgacccccccccccccaaaaaaacacttagtagcatttttaaaaaaggagaatccaa
ttttgggcaccgcttcttccatgttttcaatgaggcgggcgctgctgcgacatgtgctagcctatcaaaacaaagctagacatgttcacactgctttctc
cctatcaaagcaaagcgacccttagcttaagcttgagccaaaggaagcacgtattttcacacgcatcacgagaagagattgatagtaacttgactcttag
taatagtgaagtaccgacttccctgggttatagtgggcacttgcttataacggcggccaatcaaatctcttcaaattgagcgcactggcttataacttcc
gccacaaacatttcagtgcaaaaataccggtactagaaaaagtttgagccaagcctgccactcatttcttctctgcaggcgtgctcacaaggtgtatgca
gaactagagatcgtaaaatgggttaacgaccttaaaaaagagggggtgcctatttcgtctctaatgctagcactcgagggcaaggatattgccgctgaac
acggtataaaaggctttcaagcttcgtggtgctggtaacacactcgctcaaagcaaaactacgggagtgctgggtaatgaatcttcgcgagcagcttcgt
cagcatacaccaggtaagaattttgtgcttgctacaccgagtaggaggaaggtggcagagtggatctgcgcggcgtgggacgccttgtcagctgagactg
tcgctaatgactacaaaaaggcttggtactctcctcaacaagaccgatattgcagcagccaagctgattggtgatcttgcagcgcactgcgctgttgatg
ttgcagttggtgaagtagactctgatggtgacttcggcgatgtaaaaa