Description :
From Genome Similarity Track
Location :
Scaffold_58:50948- 52591
Transcript NameFunction/comments
Phymu_g3011hypothetical protein

Sequence
1643 bases(100 bases per row)
ATCAGTCGCGCGCAGCAAcagaaggaggcgcagcagcagaagaaggaggcggagatCAACGAGGacttcgagttcgacgacggTGGGGCGTTCCACACGT
CTGGTGGTAGCTCATGGGACTTCACAGCTGCCATCTCGCGTATtgagaagatggagagcgGCATTCCAACGGCCACCAAGCGCACATCCATTCAGGCTAA
GATTGACAAGCGCCGcaaagagaagcaggaggaaaAGCAGgccaagaaagagaaaaagGCAGCCAAGAAAGCGAAAAaagaggtggagaaggaggagagt
GACAAGGACggtgaagaggaggacagcgacgcggaggaggaagcagaCGGATCcagtgacagtgaagacgagaaggaagaaaaagaTTCTGGATCAGAGT
CTTCGGATAACGACGAAGAGCCGgatgtggaggaggaagacgtcgtcgtggaagaagagcgactgcagtCCGCGCTGCAGGACAGTAAAAAAGACCAGCA
GAGTCGCGAAGAGCTGGTAGACGCCttggaaaagaagaaggctgcggaATTCTTCGAGTCGGACCCATTTGCTGCGCAGGAGTTTGCCAAGACCAAGTTT
GAGACTTTTGCAGACTTGAAACTCTCGCGGCCGATCATGCGTGCCATCTCCCATATTGGATTCGAGAAGCCGACTCCAATTCAGCAACGTGCTATCCCGA
TTGCGCTGACAGGCAAAGATATCTGCGCTAGTGCCCAGACTGGTAGTGGTAAGACTGCAGCCTTCCTGCTACCTATTCTTGAGCGCCTACAGTTCCGTTC
GCGTCGTGTGCAGTCCACGCGCGTAATGATTATCTGTCCCGTGCGTGAGCTTGCCACGCAGTGTCAGTCGATGTTCGAGCAGTTGGCGCGTTACACGGAT
ATTACATGCTCGCTGGCTGTGGGTGGTTTGCCTCTGAAGGCTCAGGAAGCTGAACTGCGCAACCGGCCGGACGTCGTGGTGTGTACTCCTGGTCGTATGA
TCGATCACCTGCGTAACTCGAAGAGTGTCCACATGGATGACCTGGAAAttttggtgctggatgaagctgatcgTCTGCTTGAATTGGGTTTCACCGAAGA
AGTCCTCGAGCTCGTCCGGATGTGCCCGGTTCAGCGTCAGACCATGCTGTTTTCTGCTACTTTGACCTCGAAGGTGGACCAGCTGATTGATCTGTCAATG
AAGCGTCCCGTGCGTATTAGCACTGATCCGCTTTTCGATATGGCCAAGCACTTGGTGCAGGAGTTCGTGCGTATCCGTCCGAACCGTGAAGATGACCGTG
AGGCCATTCTGCTGGCTCTGTGTACGCGTACTTTCCGCACGAACACGATCGTGTTCATGGAGACCAAGTCGCACGCGCACCGTATGATGATCATTTTCGG
TCTTGCAGGTATTAAGGCGGCAGAACTTCACGGcaacctccagcagcgagagcgtTTGGAGGCGCTTCAAAAGTTCCGAGATGGTACAGTTGACATTCTT
CTGTGTACCGATATCGCCGCTCGTGGTATCGATGTGCGCGGTGTCCACGCTGTCATCAACTATGAAATGCCTAAGGATATTACTACGTACGTCCACCGTG
TCGGTCGTACAGCTCGTGCTGGCCGCAACGGCCGTGCCGTCAC