Description :
From Genome Similarity Track
Location :
Scaffold_78:50948- 52378
Transcript NameFunction/comments
Albla_Nc14059040glucose transporter putative

Sequence
1430 bases(100 bases per row)
AAACCGCGTTTGATTTTATACTTTAGCACTATCATCTCCTTGATGCAAGGATTTCAGTATGGATGGTCTGTGTCCCAAATCAACTACACTCCGTACCATG
ACGAAGCCACATGTGCAGCCAAACCCGTTGTGCCTGGAACGTGTGTCTTGTTTCCTGGACACACACAGTTGCATTGGACATTGATGGTGAATGCTTGGGT
GTTGGGAGGAATGTTTGGAAGTCTGGGATCAAGTTATCCGGCAGACAAATTGGGACGACGTCGAATGCTGCAGATGAATGCTGTCGTTATGATGATTGGA
TCGGTGCTTCAAGCTATCGCACAAAATGTATGGCTGTTTGCTGCTGGTCGATTCGTTGCCGGTATTGCATCTGGTGCTGGTACAGCTGTGTTGGGAAGCT
ACTTGAGCGAGATTTCTCCTCCTCATTTACGTGGAGCGTTATCCTCATGTATTCAAGTCTCCATTGTGACTGGTATCTTTATCGTCTCCTGCACGTTTTA
CTTTGCTGGAACTGAGCTTGGATGGCGAATCAATGCTGGAATACCGACAATTATTGGTGCGCTTAATTTCTTGGTGGCTCCTATATACATGGTTGAATCG
CCGAGCTGGCTATTAGCAAATGGGCAAGTAGAAAAAGCACACAATGAATTGGGTCGATTATTTGGACGTGAAAACATCAAAACCGCTCTCAAATGGATCG
AGAAGAAAGATCAAGATTTAGAATCCGACAATGATGTTGTTCAATATGACGAGAATGGACAAATGACACGACGTTCTTGTAAATCAACTCGACCATACGA
CACGACCAAGGTTGAGATGTCACTCATCGATGTCTTTCGATTTTACTGGCCTCAGCTCATAGTGGCATTAGGATGCTCAGCAGCACAACAATTGTCTGGA
ATCAATGCTGTATTCTTTTACTCCTCCGATATTTTCAAAAGAGCTGGATTGAAAGATGTACGAGTTGGAAACTTGATTGTCGATACGGTCAATGCACTTC
CAACATTCATGACTGGATACTTATTAAGCAAGTTTAAGAAGCGAGTCTTGCTTTTATGTGGAATATTCTGCATGTTTTTGAGCGCTATTGGGATGACCGT
GGCTTTGCTTATCAATGTCAGCATGCTCACTATCGTTTTCACGGCTCTCTATGTGACAGCATTTTCCTGCAGTTTGGGTCCACTTGTATGGGGAATCACA
GCTGAAGTATTCCCTGACCACGTTCGTGCCAATGCTCAATCGATTTGTCTCGTGGTCAATTGGGCATGCAATCTCTGCGTTGGTATCGCGTATCCGTTCA
TTGCTGCGGCGTTGAAAGATTATGGATTTGTACCTTTTGTTGGCACATTAGGCTTCTTTGGAGTCTTTATCTATTACACTCTTCCAGAGACTTCCGGGAA
GACGATCGATGAAATTCAAGCGGAGTTCAG