Description :
From Genome Similarity Track
Location :
Scaffold_749:5094- 6442
Sequence
1348 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCATTCATTCGGCGAAGATTTGCCAGACCATCCTCACAAGACTGTACCATCGGCATT
TCCCGATGCGGAAGATGTTGATCCGGTAGCGATACAGCGGGAACGACGCAGACAGATACTGGTGGCACAAGACGAGGAGCAGAAGTGGTTTAGTATCAAG
AAGGTGCTTCAGGGCCAAGCACAAGAGCTGAGTTACAAAGAAGCTCGAGATGCCTGGAAGTATGCTGACCGGTTCGTGTTATCAGAAGACGGCGTGCTTC
ACTATCTTGGATTGAATCGTCGGTACGACCACGGTTGGCAAGAGGAGACGAAGCTGCGGCTTGTGGTACCGACAACGATGATTCAAGAGGTCTTGCAGAA
CTGTCACGACTCGCTGGAAGGAGGACATCAAGGTGTGGTGAGAACGTTCCACCGCGTTAAGTCCGATTATTATTGGATCGGCTTGTACGCCGACGTGGAG
AAGCATGTGAAGTCATGTCCAGATTGCAGCTCGAGTAAAAGCCGTCCACAGCTTCGTGGATACTCACCTGGTAACGTGCTAGCCGAACGACCTTTCCAGA
TCGTCTCGATGGATTTTGTGATCCCACTACCGAAATCTCGTAGGGGCAACACGGCGTTGATCCTATTTCAGTGCTCGTTCACGGGATTCGTTATTGCCAA
GGCTATGTCAGATACGACTGCACTGAGTGTTGCCCAAGTGCTCGAAGAATGTGTGTACCGACGGTTCGGAGCCCCATCATTAATAAGGCATGACCGCGAC
TCACGCTTCATGAGCGAGGTGTTCCAAGCGTTCGCAGAGATGATGCAGTCAAGATCAAGAGCGACTTTGAGCTATCGGCCACAGGCTAATGGACAGCAGG
AACGTTCGGTGAAGTCAGTGATGGGGTCCGTACGGGTGTACGCAGAAG