Description :
From Genome Similarity Track
Location :
Scaffold_42:50935- 53755
Transcript NameFunction/comments

Sequence
2820 bases(100 bases per row)
TCTTCAAAGATGATCTTGTTTCTTAATCGCCAGAGTAGGACTGGTGTTACCGTAGTCCATATTCTCCAAATTGTTGCCATTGCTGTTGTGTGGTATGGGG
TCCATCGTGTGACGCATTTCTGTGCCATTGCGAGGAACTCCATAGTCAGTTGAGGTGCAGTTCTGGATGCTGCTGCTGATTCTAAATCTTGACGTTGTGT
TTCATTAATCGAGTATCCCATCCATTGGTTTATCCATTTCGCCCAGGCTGCCTGTGCTATTGGATATTCCCATATTATATGGTCAATGGGGTTTCGGTGG
TACATGTGCAGTCAGTTTGTGGGCAACTTCGATTAACTGGCCATCCCTTGTGCCATAAATTCATTGCTCCAATTGCCGCTCGATAGATTGTCCAATTTTG
GTAGGTTCCGCTGAAAACGCCCTGGCTTGGTCCCAGGATTGTTATCTGGGACTTTTGGTGTCAGGTGCTGGCTTTCCCCCATTTGCTGATGTTGCTTGCT
CGTTTGGGTGATCTTATCTATGATTGGTTGAAGCTCGATGTCTTGTGATTCTCTGAAGTACTTTGATCGTTGTCGTCGGAGTTGTGCTGTTATATTCTTG
GCCATTGTTGCTGTGTTCACCGCCCATGGGTACAGAGCTGTTTGCGGGTGTGCCGCAAATACTATTCCTACCACACGTTGCCATGCTTGTAGCTCTTGGA
GATCTGTGTTGTCTTTGTAGCTTTGATCCACCCACGCAATGTGTCATGTCCATCCGTCGTTGTTCAATTCGAGTCGCAGTACCGGTTTTTGTGGATCAGT
TACTACCGATGCAATTATGCTGCCCTCAGTTTTCGTATCCATGGTCCAGGTGAGTAGGTGTTTAAGAGGTGGTAGCGCGATTGGTCGTGTTGCTTGGTCT
GGTTGCTCCCATAGATTCCATGGCACGCTGTGCAGAATATAGCTGCACCATTGCCGGATGTGTTCTTCTTGTCGTCCTCTGGTTTGTGATCTTTTTGTCT
TCGGTTTGATTTCAATGCTGTATTCCCCAATCTCTGTCAGCTGCATCATGTTAGATATGTCGATTTCGTCGATTCAGCAGACTGGTATTGTTGGGTAGTC
TTGGTGTTGGAGTGGTTTTCCGGCTTTGTCGATGATATTGGCGTTGTTGTTCCAGGGCACTTGTAGAAGGAAGTCAGCGTGGTCTGGTAGTGCTGCGTTT
CGTGTCACCTGGGTTGATCTGAAATGGATGGTGTTGTCATCTTTCCAAAATGTTGATGTATGTTGTGGTCCCGCTGCTAAGACGCGTTGTATCTGGTCCT
CCTGATTCTCATCTCGGAGTATTCCTTGTGATTGTGCTTCCCAGAGTTCTAGCTTGCCTAGTGCTTGTGCTGATATTCGTAGTCGTCCGTTGTTCTCGCG
TGTTGCTGTGCTAATCATNTTCGCCGAAGTTGGTCTGAATGCGCAGCATAGTTCTGAGGTCGGCTCCCCTGGATGCACTAGCTCATGCCATGCCTCTGTG
TATGTATCTGCTGGTGTTTGAATCCATTTTTCGGCTAAGTTGCAGCGTGTTGCCTTGAGTGCTCTTGCGATGTCTTGTAGTCCTAGTCCTCCTGCTGATC
TGGGCGTGAAGAGTAGTGCTGGGTTGAGTTTGTGTGTGCTTGGTTCTGTACTTGCTGACGCCTGCCATACAAATTGTTTTTGTAGGTTTTCTAGTTGTTG
GAGCGTTGATTTGGGTGGGATGAATTGCTTTCCGGTATATAGTATAGCAGGGAGCGCTATTACATTGAACAGCATTATTCGCTGTGCCACTGAGTTGCCC
ACTTTAGTTGCAATACGGAGTCGTCGTTGAATCTTCTCGATGCGAATATTCCAGTTTTCTACTGTTGCGTCTTGATTGCCTACCCAATATCCCAATTGTC
TCGTCGTTTCTTCTGGTTGGAGGACTGGGAATCCATGCCATTTGGCTGGAGTTCCTGCTGTATTAAGTCCAATGAGTATGATTTTTCCTGGTTGCACCTG
TAATCCTGATAATTCTCCAAAGTTATGTAGCGTTTGCTGTACTGCTGGAAGTTCTTTCAGCGAGTTCAGGTAAACTGTGCTGTCGTCCACGAAAGCAGAA
AATTTGTGTCTGTGCTCATTATTTCCTGAGATAGTTATTCCAGATAGTTGGGGATGTTGGTTGATCGCATGACTGAGTATTTCTACAGCGAGTATGAATA
ATAGTGGTGCCAAAGGGCATCCTTGCCGGATCCCTGACTCAACTGTCCATTTCGTTGAAGTTTTTCCGTTTACCAGAAATCTGGCTGTTGTTCCGTGGTG
CAGTCGTTGGACGACCGAGATGAGTTTCTCCGAGAATCCAAATTTGCGTAGTACCATAAGCATGAATGTCCTGTCCAGTGTATCATAGGCTTTGCGAAGG
TCAAGACATAAAACTGCCGATAGGTCTGCCCATGCCTTGGCTGGGTTGTTGACGGTCTTTTCTAGGATGTTTCGCAGGATTGTGATAGTTTTGTCGATAT
TGCGCCCTCGTACGAATCCTTGTTGAGCTGTGCTGATAAGTTTTAGTAAAAATTGATGTAATCGGTCCGCTAATATTCTGCCGAAAAGTTTGTATGCTGA
GTTCAACAGTGCAATGGGTCGATAGTCCATGGCGTCAGCTGAGTCTCCTTTTTTCCGTAGTGGTACTATCGTAGCTTCCAAGAAAGATTGGGGTACCTTC
CAGGATCGCGTTGAAGAGTTTAGTCATTCCTGGTACCAGTTCTGCTTGGAAATCTTTGTAGAAGTCGTGGTTTAGTCCTGTTGTTCCTGCTGTCTTGTTC
CGTTTGAGATGTTCGATCGC