Description :
From Genome Similarity Track
Location :
Scaffold_119:50924- 52651
Sequence
1727 bases(100 bases per row)
GCCACTTGACTGAGATCGCGGAGGCTGCGGGAGACACTCGTTAGAATCGCTCGGTGTAGGACATTGATGATGGTGGGCATCACAGTGGTCGTCTACAATA
CCATTGCCACACCCCACTGTCGGCCGCTTCTGCCACACTACAATGCCCTCCATCATGAACGCACTCCAGCACTCCACCGTCCACCACCGCCGCCGAGTGA
AGCGGTGATCGTCTTTCTGCAACCTGGGGCGGCGGTGGCGGGCGGTGGCGGGCGGTGGAGTGCGTCGATGATGGATGACATTGTAGTGTGGCCGCAGCGA
TGGACAGTGCGTTGTGGAAATGATTGTGGACGACCACTGTGGTCTCTACTGATGCATACTCTATGTGCAGGAAAGGACGCGTTTGCAGTCGTCAGGTCGT
GCAAATGACTGGACTACCTGCTGCGCTATATTGCGAAGTCCTCAACCGTGTCGCAACTTGCGCCTCCGTGCAACTTCTCAACACAAACACAATGTTGGGG
GAGCAGTGGACTCCCGGGCAAAGCTTGGTGGTGTGTTGAGCAGTTGGAGGCAAAACTAGAACTGACCTACTCACTAACTGACTAAACTGGTCCTATACTT
CCGCAACACTCCCCCCATGCCCGTGTCCGGCACCTAGTTTGTGTAAGTCAACTCGCAACAATGATATGTAGGATGGTACTCTACAACCGTTCCAGGGCCT
CGACCAGCCCATCGCGTTTAGCGCGGTTTGGCTATTGGTCGGCAAACGACTGCACCAAAGATAGGATCTCCTGGTGCATCGCCGGGAGCTGTTCCCAGCT
TGCGTCGAGGCTCTCTAGGTCTTTCCAGCGGATGAGTAATACCCACTGGTTAGAACCAGGGTTGTGTCTTGCGTCGTCAATTTGGTCAACAACCAGCGTG
GCCCCTTGCTCACTGACGAGGTCGATAATTCCTTCAGTAATCTGAAAGTGGCTTTCCGCATAGAACTTGAGTCGTGAATGATGTGCTTCGCGCTGCACCC
CTGTAATCATGTGTTCTATGACACATGAGTAGGGCAGGCACTTGAGGACTCGGAAAGGGCCAATCCACGTGACCAGTAGCTTGGGGTAGTGTGTGTTCTC
GTCCACGCGTGACCAAAGCACAAAGTCTCCTTCTGTGACCTTCATTTCGTTTTGGTCTTCTCAAGCATTCGCTTGTTTTGGGTGGCGCGCCGCTTGTCGA
CTATTGTTGAGTGAACTTCTTGTAGTGATTTTCTTAGTTCCTCCACAGATTGCCGCAGTTCCTTCCGTTTCCAGTCGATCGTGTGGAACCCGGTCTTCGA
TAACGATGGTGTTGAGCGCTGTGGTCGGCTCCAAGCCTGTGAAGCATTCCATGGGGCTTGTGTGGTCCAGCGTCGCCACCGGCGTTTGGTTGATGTTGGC
TTGCACAAACCGGTAACAGATAATCCCATTCTGTTTTCTTGAGTTTTGTTTCTCTCAGCATGATTCGCATGAGTCCCAAGATGTCGCGGTTGACTCGTTC
GACCGTCCCGTTGCGCCATGGGCACTATGTGTGCTGTGCTCGTAGGCGCGTAGCAAGATCCTTCATGACGGAGTTCTTGAAATGGCTTCCGCAGTCTGAG
ATCCAGATTTCTGGGACTCCAAATAACGACGACCATTCCATGATGGCTTCAACTGCAACTTGGCTTGTCGGGCTGTCGCATGCAATGCGGCGACAGTAGT
GGCTCAAGTCGTCTTTAAGGACCAGGA