Description :
From Genome Similarity Track
Location :
Scaffold_146:50920- 55426
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_146-fgenesh-gene-0.17Pyruvate kinase
Pytap_DAOMBR444snap_masked-pag1_scaffold_146-abinit-gene-0.42DNA replication licensing factor MCM5
Pytap_DAOMBR444maker-pag1_scaffold_146-fgenesh-gene-0.9Phosphoglycerate mutase

Sequence
4506 bases(100 bases per row)
CTTGGTGTCGTGAAGCACGGCACGCAGGTTGTAGTTGtGgCTTGGCgACCAGTGCACACCACGGCAGGCACGCAGGTTGTTGATACGCATGAGCGCcTCG
CTGTACTCAGCGTGTGAGAAGTTGATGCGCATGATACGCAGACCCTCGTCCGTGAGCTTCTGCGTCATCTCTGGGCTCTCCGAGGCTGGGCCGATAGTGG
CGACGATCTTGGTCATCGAGAACTTCTCGCTGCGTGGGTTCTTGTACGCCTCATTGTGCACAGTGTAGCTGCGCAGGGCATTGTGCTGCAGTGCGACGCG
CTGGCGCTGCGCCGACGCGCGGATCGCGGAGGTCGCAACACGGCGGAACAtGGCGGTGTGGCGGAAGGTGGGCGAGTTGCGGAATGCGGgCGGCCGTGTT
GTTTGCGCGCcTGCCTTCCGGTTGGATTGTCTGGTGCTTGGAGAAGCAGcAGGAGAAGCAGAGGaGGAGGAGGAgAaGgAGGAGGAGGAGGTGAGCCGTT
GGTGCTTGGGTCTGAGGAgCcGCTGGCCAGCTGGCGGATCCAACGACGTCATCCGGTTCTGCTTGGGCACACGGGTCaGgAAGAACCCACGGGCAGCCCA
CCGGAAACGCATCCGTATAATCAAACCAGTTGAAGGTGAGGAGCCGACCCGGGTTTAATGCGAAAGAGACATGCATCATCTGGATAACCtGACCCGTGAA
GCATCGGCCCGTTTATGTTTTCGCATCTGCAGCCCCTGCATGCATACAACGCGTGGCGTGACACAAAACAGAGGGAGTTTGTTTGATTCGGGACTCCACA
TTCGCGATCTTTTTAGTTGCCCCACGATTCTCAAAATTCAGGAAAaCcAAAAATAAAaCACGGGCAGCTGTTAGGAACCGATTTACTtCACGCGTGATAC
GAACTTGTACTGATTCAGctGCCGCAGCGCCCCCTTCTGCACCagtAGCGCGAATGGCTCGCTGGATGGCGTTCGGGTTGTAGCCCTGCGCTTCGAGGCG
GCTGTAGAGCGCGCTCGTCTCCACACGAGCGCCGATGCGCAGCGTGCGGTTGATGCTCTGCTCCACCTCCTGCGCCTTTtCGtGGAAACCaCCGAAGAGG
CCCTGCGTGCCGCCGTCCTTGGCCGCATTCATCGTCGAGACACTGAAGAGACGGATGGCTTCGCGCACGTGCTCTGCCGTCGCTTCGTTCTGCAGCTTCA
TCTTGGCCAATGACTCGGAGATGCGAACAAGCGCTTCAAGCTGACGCACAGTGACGGGAATCGTGGTCTCGCCGCCCTGGTTACGCCGCACGTCATCACG
CACACCGACGTAGAAGTCTTGGAGCGCCTGAGCTGCCCCCACAGACAAtcGTGGCGCACACCGTGTGCGACagTACGTGATGAACTTCTTGAGTAGCCAT
GGCTCATACTCACCGGTCTTCTCATCCACGTCGGGCTTGTTGATATTGCTGGTCCCTGCCTGCGCGTTCGTGTGGATACGCACGACGTGCGCTGCCATTT
GTCGGTCTCGAGCGTCGTCCTGGATATCTCGGACGATGAAGATCATGTCGAATCGCGACAGAATCGTGCTCATCAAATCGATGTTCTCTGACGCGCTGCG
CATATCGTCGTATCGACCAAACACGGGGTTGGCGGCTGCCAGGACGGACGCGCGCGAGTTGAGGATCGTCGTGATGCCAGCCTTGGCAATCGAGATGGTT
TGTTGCTCCATGGCCTCGTGGATGGCCACGCGATCGGACTCGCGCATTTTATCGAACTCGTCAATACACACGACGCCACCATCGGCCAGGACCATCGCTC
CGCCCTCCAAGTAGAATTCGCCCTTTGCGTCTTTGATCACAGACGCCGTGAGACCAGCAGCACTACTGCCCTTGCCCGACGTGTACACGCCcACAGGTGC
CACTTTCTCCGTGAACTTGAGGAACTGACTCTTCGCAGTCGATGGGTCTCCGAGGAGCAGCACGTTGATATCACCTCGTAGCtaaaCATTGTCGATATGA
GCGCAAGACCCAAACgAaTGTATCGGCCACAGAGCTCACTTACAATCATGCCATCGGGGAGGCGCTTGCGTGAGCCACCGACAAGTAAACACGCGATTGC
CTTTTTGATGTTGGTAGTGTAGTCACCATAAATCGATGGCGCAATACTACTCGCGAGTTTCTCATACAGCTgCGGGTCTCGGGCCATTTCATGGAATTTC
TCTTCTTCAGACGGTGAGAACGTGGCCTTTGCACGGCCTGCGCCTTCTTCGTCGATCTATGCAGCACAAGTTAGGATCTAGTAACAGGCGACGGCCCGGG
CTCACAACGTACCTCAATACCCACGACGCGAAGGTACAATTGTCGAATCGCAACGGCGCCAATCTGGCGTGTGCCTGCGTTGACAACGCTTGTGATGCCG
ACAATCGAGACGCGGGTTCCCGGAGAAGCACGATCCACGAGACCGCGATCAGCAATGAGAGCAAGGTTTCGTGGCATCTCACCGGTTGGGACTACCTCTG
GGTTCTCCTGCAGCTTCAGTGTCTGCTGGTCAACGTAGTCACATCGGTCCGGCACGATAATGTACGAGTCCTGAGGGCATTGCTCTCCTGTTGGATCATC
GTCGCGGTTGCGATCGCACACTCGAGGGATATTGACGCCGCCGAGTCCAGCCACTGCAACACGCTTCGTGTTGCCACAGTGCTTGCAGCGCAGTGTCGCA
GCCACACACTTGGTACGTACCCTCGTCGCACTGATAATGATGCCAGGCACCTTCACGAGCTTGTTGATTTCTTGAGCGTGCACATGGCGCAAGGGTACAT
GCGCCTGGTCACTTGTCAGCATCACTTGGATATCTGGCAGAGCTTTAATATTGACTGGTTCGTTAGCGTCGTTGGGCGTGACTGTCGCTGCGTCTGCCTC
GCTTCTGTTAAGCACGAGTAAGTACGCCAGCATCTCCTTCGCAGCACTCTCCAGCAACGgAaGATACTCcTTCGGgTTCTTCAgAaTgAaGTCTtGCAGG
AGCTGATCAtAGGTCGaCAAGTGCGTGAGGTTCATCGTGAAGGAGTAGTTGCCGCGgCGGAAGTTGGCAATGAGCTGCTCGCGATAGTAGAAGATGGGGC
CGACTCGAAaGTTGCGCAGGAACTCGAGGAGTCGGCGCTGGATGGCGATGGGAGACGTGTCCTGCGCGTCACGCGCAGCCACAACGGCTGCGCTCTCCAT
GCCCATGGACGTCACTCGTCCTGCGTCCCAGTCCATGGCTGCTGTGCTGTGGtaTGCTGTGCGGtGCTCACGCGGTGGCGCGAGTGCCGGGCGCTTgaCT
ATGGAGGGAAGCGACGCGTTTGgCGCGCAAAAtGCATGaGCtCTTTTGCTTGGGCGAGTCTGTTATCAACCGCAATTTGTTAGGAACTGTGCCAACTTCC
AATTCCTGAAATTTCAGGAATCGgAAAaGTGCCGTaTGTTGTTTTtGTTTCCAACaCTGCGATCTTtCTGTTTTAATCCGTATTACCTGTATATCgCGAT
AACCGCAATAAAATGGgTgATGGGCCTGCTCAAAAGaCTCACGCGTATCAAGTCTGCGAGgTAGCAGCTACTTCGACACCGCTGCGTCATCCCTGGCACT
TTGCGGCGCCCGTGcctccTCCGATCATtCCCcAAGAGACCAAGAACcTCCcAaGATGCCTGGTGCGTTCTGTCCAGAGGAAGCGGCGCCGCATGAGACA
aCgcACTCATACGCGTGTGAACTGTAGCCAAGTAtcAGCTCGTGCTCATCCGCCACGGCGAGTCGCAGTGGAACGTGGACAACCGCTTCACGGGCTGGCA
CGACGTGCCGCTCTCGGCCACGGGTGAGAAGGAGTCGCATGATGCCGGCAAGGTGCTCAAGGAAAaCGGCTTCCAGTTCGACTTGGCCTACACCTCAGTG
CTCAAGCGCGCCATCAAGACGCTCTGGAACATCCTCGAGGAGATGGACCGCATGTGGATCCCTGTGGTGCGCTCGTGGCGCCTTAACGAGCGTCACTACG
GTGCGCTCACGGGCCTCAACAAGCAGGAAACTGTGGAtAAGCACGGCATCGACCAGGTGATGGTCTGGCGTCGTAGCTACGCTATCCCACCACCGGAGCT
TGACGCCGCCAGCCCGTTCTACCCGGGCAACGACGTCAAGTACGCcGATGTCGACAAGGCCGAGCTGCCATTCACCGAGTCGCTCAAGACAACTGGTGAC
CGTGTCGTGCCATACTGGGAGAACGTCATTGTGCCATCGATCAAGGCTGGCAAGAAGGTGCTGATTGCTGCCCACGGCAACAGCCTTCGTGCCCTTGTCA
AGCATCTCGACAACATCTCGGAGGACACCATCACGGGCCTTAACATCCCAACGGgCGTGCCTCTCGTGTACGACCTGGAtGAGAACTTCAAGCCAGTGCC
ACACCCaGACGCCATTGCGCCACTGACGGCCCGTTACGtcGGCAaCCAGGAGGAGATCAAGGCGCGCATTGCTGGtGTTGCCAACCAGACCAAGGCCAAG
TAAAcG