Description :
From Genome Similarity Track
Location :
scaffold_4:50919- 53049
Sequence
2130 bases(100 bases per row)
tcagtacgtggctggaacaacCAGTGCCtctacatttaattaggttatactatatagataggaaaacctatagattgaGATAAACGCGGCTTTGCTGTAT
AGAATAACGGAGAAAAACACTTTACATTTTAAGCGggagagttaattagcctcgggttaaggttgtagttactcttggagtaagtcaATTGCGGTTCGCT
ATACTCAttctggttctaagtatatagaacgaaggtcgccgacctcaAACAAGCTCCCTCTTAACGAAAGAGCagcggtagccccgctgtactTGGAAGT
ACTTgcggtcaatctacacctgtgTGGTTACGAATGATCCTCTGTTAAGACGGAGCAGTTCTCCTatctgccccagggcatgcaggacgggattAAAAAA
CTGACGTCTCTGCttgaccctgagggcgtgcaacacattGCTTCGCGagaacctgaagcgatcaacgCGCGCCTAGACGCGTATACCAgcaataaaaatg
ctctgctagagcacctagagcagaagatgtcagcGACGACTACGTCCGTGATGCCACCGTTGGTGGCGGATGATTACCCCGGACCCGAGCCGCTcctggt
gagcgttaagaccttcgaggtcAAGGGTGGAGAAAATATTCCGCTAAAAGTGAGAGagatcgagatggccatggtgTCCGCCAAGTTCttgaccgagcaa
cagcccgtggcgctagctatctctaagctcGGGggttgagcgcgagaatgggcattgACGTGCAGCCCTTCGgtcgaaaaaaaaatcatatttCCCTCCt
gaacggagctgaagctacagctttcacgagtgttctcgccgtcatatcgcgtgcgatcgcgttttcttgccgcccgacagggcaagaaggaattggtgga
acATACCAAGAGTTGCGCACTttattgccggtatggcttCCGATCCTCTTCCGAAGCTGTCACAGTGACTGTCTTTATGAAGGACCTCTGCACTGTCGTG
GCCAGAAGGgatgtcttccgtgtgcacccgtcttcatttgagaaAGCATTGGTTGTCGCTTTGGATGCCGAATTcagctttaagtcggcacgactcgCAC
ACtctaacagctcgtcgagcggacctgAGCCGAAGGAACTCTGCAcgaggcagagctccgagttgCTGGGCTGTGATCGAACACCCGACGCTTCTTTGTA
TGTGAGACACCCATCACCTTCGTATTGGTTGTCTcctgcacaaggcgcgttaaggttcatcgaaccaacgtcccgcttcttaccactcttctggtttgtc
gcggggaacgACAAGACACAGTAGGCTCGAGGCGGCCTACTGGGAAGATCTAAGCTCTGTTAAACCTCAAGGTGGCAGAGAGCAGCAGGGATCAGCCACA
AAGAGTGCCGTTCTCTTGAACACAAAACCTATGTGCAAGCCAAGCTtgttggtcgtaaaagcgaccgtgaagggctttgagaaccCATGGAAGATCCCGA
TCGACTTCGGGGCGCTGAACACTTATTAtcaacgctccacgattgaaggaagtcagctgaatgctaaggtgctgaaagcgcggttgagtgacatcgtcac
tgttcgcctttAGCTTTACTGTGCCGAGGATCCAAGTTTCGTGAGTCCGATGACGTGGAATACTGCTTAATCTTAGACTTGGGATCAAGGTATGTTCTTA
TCCTtgatatggcatggttggaacacgatgagccatggatcgattggaagtcgaagaccttgggcgctacgcccacgactcctggtggagctttggtgag
tcatgaacccacctctactaggaggcaaaaacgctatttacgcgggcactggaccggggcgGTCAACGTGTGGAACTCGGAGTATTCgttttgtcgaaca
ccgaaggtatTTCGGACActagtcccgagcatggctcgcgggctacgtgagtggcacgtaaatacACTGAGCAcggctcacgtttcgaagcagtcgctgc
atgccaagagttccgaggcatcaagtcGGTCGAAGTCCGAGACATCTTGAACAAGGCCtttagatgcgcgtgaaatggcacgttatccactggacgaaga
ctgtggaGCTAGCTGcatttcgtcggatgt