Description :
From Genome Similarity Track
Location :
Scaffold_161:50914- 52958
Transcript NameFunction/comments
Albla_Nc14087770conserved hypothetical protein
Albla_Nc14087780
Albla_Nc14087790trans2enoylCoA reductase putative

Sequence
2044 bases(100 bases per row)
AATACCGATACGTCTCATTCAAGTGATCCTGCGTCTCCTCTTTTGTCTCGATATTCTCTATCACACGGACGTCTCGGATCGCATACGAGTCCACGAAATC
GCATTTATGTCGAACTTTTTCATCCGTGTCCGAGTACTCTGCCGCGACCAAATCTTCAGTGTTACCCTCAATGGTCCCATATGCGGTCAAGACTGGGGGA
TTCCCCTTTTGGATCAGCCGATTGCGATAGATATCCACATCCTGCTTCCTTTTGATGTATTTCCACTGTTTTGGGTGTGCAAAGTGCTTCTGTTCGAACT
TCTGAAAGCTTCGAATGGCGTGGTGCAACGTGACCGAAGCTTCCTCGCGATAAAAGTGTTTTTGAGGCAAAGTTAACTTGACTTTACTCCATTCCGGAGG
GAACACTTGGACCGAGCTAAAGCCTGTTGGGTTCTCACGCTTGAGACTCCGCGGAGAGCAGAGGGAAGGAGAAGGAAGCGCAGGTGGCTGTGTAGGATAG
TGTGTAGCCATCTGACTACGTTATGAGGCGTGGAAGCAAGCGTAGCAGGAGAATAGACAAAAGTATCTGCTCAGGTCAGCCGACTTTGCAATGTGATTCG
GCCTGTTCGTTTAGTGAGATCGCAGTGTATTATTTGAAACAAGTGAATGAACGATAGGCGTAAAAAGGCCCACTTCTCGCTCTCAGCTGTTACTTGAGCT
TATAGATCAAAAATCATGGCAGTCTCGAGTGTGTTCTTCTATTTTTTGGATCATAACCGCCCTACGATCGATCGAAATTGGTACGGAAGGGTACAATTGC
GGCTTACAGACTTTTTTTGGTAATGAAAAGGGTGCGTGTGGGATCACTGCACTTTTATCAGTATCAGTGCAGCCGGAGAGAGCATTCTACAAAGAAGCAA
GTACGATATTGAGACATGAGTCTGCGCTCTATGCGAGTTTGCATGCATCAGAAAGCTCCATTGAGATATAGAGTGTATGTGTTTTGAGGGGAAATGGGTT
GTAGAGAGTATATGAGATTTATGAGGCGCAAGCCGTAGATGCGATTTACTATGTTGACGATTGCTTTTCGCACGTCAAAGCCATATCAGTCGAGTCAATG
ATGGAGCGTACGCTCTACAAAAGATGAAGTAGGTCGACTGTAGTCAGTTCTCCACGCAAGGCGCACCCTTTTACATTGAGGAAGACTGTCTTAATGAATT
GGTTCCATAAATTTATAGAAGTTCATATTTCGAAATATAGATAGACCTATCTCTTCATTTACAAAGTAGTAGAGGCTATTAATCTGCAGACTGCGGTAAA
TCAAAGCGCTCCTCAAAAGCATGTCCATGAATCATTGCTTTCGCAAAGCGCGCTTCATCCAAGCCAAATCGGTCCATCAGCTCTCACAACGACTCTCCAC
AATCCGCTATGCAGAGTATGGTCATCCTTTCCAAGTGTTAAAGTACGATCTCCCCTCATTCCTCCGCTGTATTCTAAGCTTTCAACCGTAGGAAGGAAGA
GGATGACAAAGAAATGCAGCCAAAGGAGAACCAAATTGCGATCAAAATGCTAGCAGCACCCATCAACGTGGCTGATATCACGCAAATCCAAGGAAATTAC
CCAATTCGTCCATCGCTTCCGGCTGTGGCGGGAAATGAAGGTGTTGCATTGATCACAGCGGTCGGTTCTAACGTCAAAAACCTCAAAGTGAATGATCGTG
TGGTTCCCTGTAAATTGGGCTTTGGTACCTGGCGATCGAAAGCTATCAAAGATGCCCAGGACGTCGTTAAAGTGTCGAGCAAAATCGCGATCGAAGACGC
AGCCACGCTCACAGTCAACCCGGCAACCGCTTATGTTCTCCTGAAGGAGTTTCAAGACCTGAAAGAAGGCGATGTGGTCATCCAGAATGCGGCCAATAGT
GCAGTAGGAATGGCGGTGATACAATTAGCTGCTTTGCGCGGTATCAAGACGATCAATATTGTGCGAGATGATGCGGATTATGACATCACCAATGTTCACC
TTAAAGGCCTGGGGGGTACCATTGTAGCCACAGCAGATTATCTT