Description :
From Genome Similarity Track
Location :
contig_28:509109- 510843
Transcript NameFunction/comments
g6678.t1hypothetical protein

Sequence
1734 bases(100 bases per row)
GCTGAAGAGCCGGCTGATGCCGCTGCTAACGAAGCTCATGGATAGTGAATATGGCTGGACGTTCAATAATCCAGTCGATCCCGTGCAGTGGAATATCCCA
GATTACTTTGATATCATCAAGTGTCCAATGGACCTCGGTACAATCAAAAAGCGACTGGAAAGCGAGCACTACAACAGCGTTGAGGCGTTTGCAGGTGATG
TGCGTCTGGTCTTCGAGAACTGCATTGCCTACAATAGCAGCACGAACAAGTTCAACATCGCAGCGAAGCAGCTACTCGCCTCATTTAACAAGTCCTTGGC
GTCGCTCAAAAACCAGCTGGAAAAACAACTTTTCAAGCGTTGCGAGCAACGCCGGGAGGAGATGTGTCAGTTGTGCGGTGGGGACTCGTTCAAGTTTGCT
CCATGCATGCTGTTCTGCAGCGGTCCGTGTGCTGGTCGGATTCGAAGACACACGCACTATTACAGTGATCCTCGGGGAGAGCATCATTGGTGTTCAAGTT
GCTACAAGCAGATGAAAGAAGGCCCGATCGACATGTCACTTCTTCCCCAACTATCGAGCGCTGCTACAGAAGTGGCACCTCCTCCTGGTGCTGGTGCTGC
TCTGTTCGACGGAGTGTTGAAGAAGTCGTCGCTGGTAAAGCGGAAAAACAGTGAGGTCGCCGAAGAGCCATGGGTAGAGTGCGACTCGTGCAAATTGTGG
TACCACCAAATTTGCGCTCTGTTCAATGAACGCAACCACGCGATCTCGGGCGAACAAGAACCATTTGTGTGTCCCATCTGTGTGAAGAAGCAACGTGCTA
CTGGCGTCAAACCGTCATTAGACAATGGTCTTAAGGCTAAGCGGCTTCCGATCACCCGCATGGCGAAGTTGATTGAGACTCGCGTAATGGAGGCCATTGA
AAAGGCAGGCAAGGACGAGGCCGTGCGCATGGGTAGCATGGGCAATTCCGACAGTATCGGCTTTTCTAATGGTGTCAAGGAGTCTGCGTCTGACACACAG
TTTGGAATTACCATTCGCGAAGTACTCAGCATTGATAAACAAGTGCAAGTCAAACCCAGAATGGCTAAGCTACTAGCGGCGAAGTATGGGAAGACCAAAA
AGGCTGAAACCGGCGCCACGGCAACTCAGTCAAAGTCCTTAAAACGCCCACGATCGACAATGTCTGCTGCCGACAAAAAGGCTGCTGCGTCTGCCTCAGC
TTCGTCAGTTTTGTCGCTGCAACTGACGTATCGCTCGCGATGCATTTGCGTCTTTCAAGAACTGGATGGTGTGGATGTGCTGATCTTCACACTGTACGTG
CAGGAGTATGGTGCAGACTCCCTATCGCCCAACGCTGGGCGTGTGTACGTGTCATATTTGGATTCGGTGAACTACTTCCAACCGAAGAAGCTGCGCACAT
TGATGCACCAGCAGGTGATGCTGGGCTTTCTCGAGGATTGCAAGAATCGTGGCTTTCACACGTGCCACATTTGGTCTTGTCCACCACTGAAGGGCGACGA
CTACATTTTCTTCTGCAAGCCAGAAAACCAAAAGATTCCGAAGTCAGCGCGACTGCGCCAGTGGTACCAAAAGCTGTTGCAGCAAGCGAAGCATGACGGC
CTTGTAGCCAATATGTCCAACTTGTACGCTGAATACTATATGAAGAAGAAAGCAGCCCACGAGCTGCCCTACTTCGAGGGCGATTACTGGCCGCGGCTCG
CTGAGGATCTTATTAAGCAACTGGAAGAAAAAGA