Description :
From Genome Similarity Track
Location :
Scaffold_61:50906- 53059
Transcript NameFunction/comments
g13892.t1RAW43663.1 hypothetical protein PC110_g158 [Phytophthora cactorum

Sequence
2153 bases(100 bases per row)
CTTTTGGCTCGCGCAGACTCACATGCAGGTAGAGCATGTTGATAATCGCCTCGTGCTCGTCCTCGGTCTCAGCGTGTAGCTCATTGTCCACAGTCACTTC
GTGTGGAATGTCGCGTTGAAGTCCGCCGATGGCAGACGATGAACAGCCCACCGTTCCGAGCCAGACGCGAGCTAGCTTCGAGAGGAACGGGTACCGCTTG
CGGTTATCGCGCCACCACTTGAATGGATCCGTTATACGCGCCTCGCGCTTCTGATGCTTGGTCAGGTACGCAGCCACCTCATCCGCCACGCACATCCGCG
TCTCCTCTATGCGAACATCGTCGAGAGGAGGCGCTGTCTCCTCCTGCAAAAGCGTGCGCATCAGTCCTTGTGCAGGAGTGTCCTCCCGGAATAAGTCAAC
AGTCTCCTTTACTAGCGCTAACTGGCATCGCTCTCGCTCGCTCTCGCCGACATGCTCCATCTTCGCGTAGCGTGGATCCAAAAGCGAGCACCACATCATC
TCCGACAGCAAATCGTCGAAATTCGCACGTAAGCTTTCGATGACGCTCTTTTGAAGCATTACGAGATCACGGCTAATCTCCGTCGCATCAAATCCGTACA
TCAACCGGTACTGCTTAATCAGACCATCCAGCACGTTTTCCTGGTTTAATTGGTGCTTGGAAATCACCAGGCAGTGGATCATGAACGGGAGAGTTCGAGC
TTTGTCGCTCGTGGTGATCACCTGAACTTCGCGCAATGTACGCAGTAGCAACAGGAGGGCTTCCGCTACAAACCACATCTTCGCAGTAGGCTCGGGGATG
TTGTGGGCCATTTCTTCATCGTTTTCAGTGTCCAGCGATGCAAAAAAACGATTGATAGAGGGTCTCCAGACCATCAACTCGGTCAACAAGTCATACACCT
GCTCCCATGAAGTGCAATCGGTTTTCCGAATTTTCAAGCTCTCGTCGTCCCCACCAGTGATCTGAGCGCGCAAAAGCGTCTGCTTCACTTCCCAATTATA
ATCCAACGCGTCTGCCAGTGCCCTCAGATCTGCAATCACCCCCCAAACGTTGGATTGGGCAGTCTGTTTGGACCTCACGCTTGTGCCAGCGTTTGGCGCC
GCAGTCGTAGCGTTGGGATTGCCGAGATCCCGAGGTCGCCATATCCAGCGAAGAAGGGAAGTATGAACCACTGCCCAAATGTCAGGAAAACGCTTAGCTT
CGAGGGCCGATGCAACGTGACAGCTTATCTTGTCGTTATTGCTCAGAAGAAGTGACAAGTTGTTCTTTGGGAGCTGCCACTCCCGTAGAATCGCCTTGAG
GTGCTCACCCAAAGCGTCCGCACCGCCGTCCTCTGGAAACGGCACGTAGACCACACCCAAGGGTAACGTCGCCGACTCGAAATTCGTGTTCATGTGGTGG
CACAGCAGTGCAAGGTACCTGAATCTCCCACCCCAATTCGAGTCGTAGTGCGTTTGCCAGATCTCTGCGGAGAGCGAGAAGTGGCCCACCTCCTTCTGAA
CCTGCACCATGGTTTTAAAACGGAGATCTGCCGCCTTCTGCTCCACTATGCGGCACATAGTTGTTCGATCTGGTACCGTTGCTTTTCCTTGCGAGAGGAA
CTGGATCAAGCGATCGAAGCTCGCGTCGGTCACCACCGACAACGGTTGGAAGCTGCAGCACACCCACTTGATCATCAGGTGCATGGCTGTCGGGTCTCCA
TAGTACTCGCGTCGGGACATCTCAGGCCGTACCTTCGACGCCGTCCGGCCCTTTTTGGGCGCAGGTCCCTGATTATCGCTTGGCTCCATGGAGATGTCTT
CACCCCCCGACGATTCGGACGACGAGCGCTTCCCATTGCGCTGAGCTTGTTCCGTTGTGGCTGGAGCCTTCTCTTCAGTCTCTCGCATTGCCAGATAATT
CTTGAGCTCTCGCGGGTGCAGCTTTTGCATGTGGTTACGCACCGAATTGCTCGATCCTTTCCGAAAAGAGAAGGCCTCGTTGCACTGTAGACAATAGGCC
TCCGTGACGTCGTCGGTACTCCATCTTGTCTGGCCAGCGGGGAGAGTGCGGCCAGGGGGCGCCACGAGCTTGATGAACTGCCAGTACTCGGGGCGCCGGA
TGCGCGGACACTTAAAGAGCGTCAGGCCGCGGTGGTCCAAGGAGTTGCTCATG