Description :
From Genome Similarity Track
Location :
Scaffold_1843:509- 2069
Sequence
1560 bases(100 bases per row)
TACTCCTATGGATCGACCAGCACTCAGGTTACGTGATCGCGTCGGCCAACCCGAACCGTGAAGCCCAGACCGTCGCCGAATCGTACGAACGCTGTGTGTT
CCGTCGTTTTGGTGCTAGTGAGGTGATCCGGCATGATCGTGAGCCAAGCTTCATGTCTGAGGTATTCAAGGCATTCAACCGGCTGATCGGGCAACAGAGT
CGAGCGACTCTAGCCTATCGACCTCAAGCCAACGGTATAACCGAGCGCATGGTGGGTACGATCACCCGAGCCATCAAGATGTACGTCCAGGACAAGGATC
AGAAGGACTGGGACGAGTATGCCGAGCGACTAGTGTTTGCACTGAACACCGCGTATGACCGGACGAGGGAAGAGACACCACACTACCTTGTGCACGGCTG
GGACCCCCGGACCACGCTCGAGGTGGCCACGCCAAAGGCGGATCCAGGGATCTCGGCCACCAACCCGAAGGTCTGGCGCAACATGGTGCAACGCGACTAT
ACGTACGCTCGTGCAGCCGCCAACCATCTGCTGGAAGCGGCGATGCAGGATCGGGCCGATGTGGCCAACGGGATCGCGACCGGAGGTGACGAGATCGTGG
TTGGATCCCAAGTGTGGTTGTTCTTCAACCGCACCAAGCCTGGTTACGCACGGAAGCTTGCCCACCTGTGGCACGGACCGTTCAGGGTGGCGGATCGTCT
CGGACACTACCTGCTACGACTCGAGATCCAAGGCTCTGAATACCAGTTCTTCCCAGTTGTCCATATAAACCGAGTGAAGGCACGACGCACCTACCCGGAG
CGTCCCGACACCGAGCTCGTGACGGAAGGTGAGCGTTTCGACTTCGACGAGGCTCTCCTGCCTGAGGACAGTTGGGATCCACAAGAGGAGACCGGCGAAT
ATGAGGTGGAAGCGGTCTTGGATCAACGGTATGAGAAGCGGACTCGGCACGGACGCAGGATCCGCGAGTATCTGGTCCGGTGGAAGGGTAACTACCCGCT
GGACTGGATCGCTGAGGACAGTCTCAACTGCGGCGGGCTGGTCTACGAGTTCGAGCAACGGCGGAAGGCTCAGGGGCGTCTGCACGCTGTCGACGCCGAA
GAAAATGAGGCAGGATCCCCATAGATCTCACCCAATCAGCGGCGGTTCGGAGTGCGAGTGACGATGTGGCACACCGGACCGATTTGCGGTTGGGGTCTGG
AGGGACGATGGTGTGAAGGATGAGATGAGCGAGAGTGACGAGTGGATCGGCCCGGAAATGAGTCCGAGAGGCGGCATGGTGACGGATCAAGTGATGAACG
GTGGTGAAGTGATTAGTCGATGGATCGGAGGTGTTCGCGGCGGAATCAAGTGGGGAATTGGCAGGAGACGTGATCGCTCATGGACTGGAGGTACCAGCCG
TAACGGAGGAACGCGTCATGGCGAGGGCAGAGAGCAACCGAGCGGCAGTTGTGCGATCGGCAGCAAGATCGCGAATGGCGATACGATTCCTGTGGCTGAA
CGAACCTTGTCTTCATTCATCCACATGAAGGGGCGGCTGTGGTAAAGCGTAGGCCGACAC