Description :
From Genome Similarity Track
Location :
contig_28:508918- 510652
Transcript NameFunction/comments
g6996.t1hypothetical protein

Sequence
1734 bases(100 bases per row)
GCTGAAGAGCCGGCTGATGCCGCTGCTAACGAAGCTCATGGATAGTGAATATGGCTGGACGTTCAATAATCCAGTCGATCCCGTGCAGTGGAATATCCCA
GATTACTTTGATATCATCAAGTGTCCAATGGACCTCGGTACAATCAAAAAGCGACTGGAAAGCGAGCACTACAACAGCGTTGAGGCGTTTGCAGGTGATG
TGCGTCTGGTCTTCGAGAACTGCATTGCCTACAATAGCAGCACGAACAAGTTCAACATCGCAGCGAAGCAGCTACTCGCCTCATTTAACAAGTCCTTGGC
GTCGCTCAAAAACCAGCTGGAAAAACAACTTTTCAAGCGTTGCGAGCAACGCCGGGAGGAGATGTGTCAGTTGTGCGGTGGGGACTCGTTCAAGTTTGCT
CCATGCATGCTGTTCTGCAGCGGTCCGTGTGCTGGTCGGATTCGAAGACACACGCACTATTACAGTGATCCTCGGGGAGAGCATCATTGGTGTTCAAGTT
GCTACAAGCAGATGAAAGAAGGCCCGATCGACATGTCACTTCTTCCCCAACTATCGAGCGCTGCTACAGAAGTGGCACCTCCTCCTGGTGCTGGTGCTGC
TCTGTTCGACGGAGTGTTGAAGAAGTCGTCGCTGGTAAAGCGGAAAAACAGTGAGGTCGCCGAAGAGCCATGGGTAGAGTGCGACTCGTGCAAATTGTGG
TACCACCAAATTTGCGCTCTGTTCAATGAACGCAACCACGCGATCTCGGGCGAACAAGAACCATTTGTGTGTCCCATCTGTGTGAAGAAGCAACGTGCTA
CTGGCGTCAAACCGTCATTAGACAATGGTCTTAAGGCTAAGCGGCTTCCGATCACCCGCATGGCGAAGTTGATTGAGACTCGCGTAATGGAGGCCATTGA
AAAGGCAGGCAAGGACGAGGCCGTGCGCATGGGTAGCATGGGCAATTCCGACAGTATCGGCTTTTCTAATGGTGTCAAGGAGTCTGCGTCTGACACACAG
TTTGGAATTACCATTCGCGAAGTACTCAGCATTGATAAACAAGTGCAAGTCAAACCCAGAATGGCTAAGCTACTAGCGGCGAAGTATGGGAAGACCAAAA
AGGCTGAAACCGGCGCCACGGCAACTCAGTCAAAGTCCTTAAAACGCCCACGATCGACAATGTCTGCTGCCGACAAAAAGGCTGCTGCATCTGCCTCAGC
TTCGTCAGCTTTGTCGCTGCAACTGACGTATCGCTCGCGATGCATTTGCGTCTTTCAAGAACTGGATGGTGTGGATGTGCTGATCTTCACACTGTACGTG
CAGGAGTATGGTGCAGACTCCCTATCGCCCAACGCTGGGCGTGTGTACGTGTCATATTTGGATTCGGTGAACTACTTCCAACCGAAGAAGCTGCGCACAT
TGATGCATCAGCAGGTGATGCTGGGCTTTCTCGAGGATTGCAAGAATCGTGGCTTTCACACGTGCCACATTTGGTCTTGTCCACCACTGAAGGGCGACGA
CTACATTTTCTTCTGCAAGCCAGAAAACCAAAAGATTCCGAAGTCAGCGCGACTGCGCCAGTGGTACCAAAAGCTGTTGCAGCAAGCGAAGCATGACGGC
CTTGTAGCCAATATGTCCAACTTGTACGCTGAATACTATATGAAGAAGAAAGCAGCCCACGAGCTGCCCTACTTCGAGGGCGATTACTGGCCGCGGCTCG
CTGAGGATCTTATTAAGCAACTGGAAGAAAAAGA