Description :
From Genome Similarity Track
Location :
Scaffold_88:50878- 52281
Transcript NameFunction/comments
Phypl_g2820conserved hypothetical protein
Phypl_g2821conserved hypothetical protein

Sequence
1403 bases(100 bases per row)
CGACCGCAAGAGACCTGGTGATCCGGCCTGGAGTCAAACGCGATACCACAACATGTGGgagtcgctgctcgaggagttcgagctcaacgagcgcttccag
aACCTCAATTTCAAGCTGGAATTGATTCAACACAACACCAAGGTGAGTTATGCCCCTTTTAGTGAGGCGTTTGTTGTGACTGTGTTGCTGACGTTGTGGT
TGTCTGCGTGTGAAGTTTTTCTTGGAGGTGCTGGATTCCCATAAGGGCGAGCGACTCGAGTGGTACATTATCATCCTCATTTCTGTGGAGTTGGGTATTG
GTGTCTACGAGCTGCTCATGAAGCTAGCTTAGATCGATTAGTGAATTCGTTTTGCCAAGCTTTCGGTCCAGAAGAATGAAAAGTCGGAGATACACTCTTT
CCATTAGACAAACGCTGCAACCTCCCGCCTACTGACGTCTACACGGAGTGTCTTGCTTCTCCAGCTACTTGCTCTCTCGCATGTCGCTCTGTCCATCTAT
CTCTTGGCCCACTTGGCATGCTCATGGGGAGCCTTGCGGTCCGTGAACGCCGACGCCGGCTGACGTCCTCCGCTGTTCACGTGCTTCCAGTAGTTATTGA
AGGACACGAAGTCCTCCGGACCCAGGTCAACCGTCTTAGAGCGCAGCATAGCGGCGAGAAGcgagcgcagcttctccacctgaTCTGTTGACAGCGTCTT
GGAgttctcctgcttcttgctgtgACTGCTGCTCGGGAGCTTGGTCGGGGTCAGATCGTCCAGGTTCAGGTCCTTGGCGCTCAACACCGTCACACGCATG
GTGTGGTACAGGTGGAAGGCGGTCCAAAAGAGGTGAGACCAGGCACCGCCAGCAGTTTGACTCGGACTGAAGCGCTTGAACTCGTAGCGGAACGCCACGA
GGTGCACGCGCGTCTTGACCGGcaggttctgcagcacgggGGTGAACCTCAGCACGGCCTTGCCGTTGCTTCTAGCTCCTTCAGGGAGCACGACCACGGG
TCCAGAGGCGCGCCGCACCACGTCCGCGATCTTCCTTGTGGGCTTGACGCGCTCAGCACTCACCGGCATGGCCAGGGACCTGTACAGTGCCTCCAGCAGG
CCGCAGACGTGCACGAGTCCCCCGTCATCACCCTTCCCCTCTGTGGCGAACACAAACACGGGCGAGAAGCGCTTGGCCAGGTACAGGACCTCCAGGAAGC
TCGTGTAGTTGCagaccaccacgtcgcccggCCCGACGCGGGTCGAGCCCTTGGCGCTCTTGGCTTTGGCCGTGGCGAGCCCCAGACGACGCGTGTTGGC
GCCCTCCTCCGAtgcgaagacgccgaagagcaggaggaggagcgagcACAGCAGCCACTCGATCAGGCGCTTCAGCAGGCGCCCCAGGAACGGGATCGCG
GAC