Description :
From Genome Similarity Track
Location :
Scaffold_43:50874- 60574
Transcript NameFunction/comments
Phypa_INRA-310PPTG_14405hypothetical protein
Phypa_INRA-310PPTG_14406Pro-apoptotic serine protease nma111-like protein
Phypa_INRA-310PPTG_14407hypothetical protein
Phypa_INRA-310PPTG_14408exocyst complex component 4

Sequence
9700 bases(100 bases per row)
GAAAGCTGAAGTGGGAATACCTCGCACATTACTCAGAGCCTGAACTTCGTACCAGTAACTCAGACCGATGTCGTAATATCTTTCTGCTGCAACAGTGTCA
GGGCCGTCCGCCGCCTCTTTTCCGCCCTTGCTGGCAAAAAGTACAGCAGCTTCATACGCTTTCCGTCCTGCGCTGATAAACTCCACCCAGCTGGATCCTT
CGCTTGAAAAGTCATCCGGCGACAAGTAGAAAGCGAAGCAATGAATATCACCGATCAACTTGCACGCTTCCACAGATCCTGAAAGTGGAGAAGTAGATGG
CAGCCCCTTCATCATGCGCGAAGCCTCCTTCAGATTTTTAGCAGCATTGCCATACAATCCCTCGGCGCATAAGTATTTAGCTTGTTGGAAAAGTAAATCA
GCGTAAATCATGGAAGCCACCGTCACGTCCGGCTCACCATTCGACAACTCGCCAGTAACAACAGGTCTGATACGCTCCAAAGCATCATCGAAGAGCAGCA
ATGACCCTTCAATTCGAGCCAATTCACAGCGAACGCACCAGCTTTCTTCACCTAGTTCGATGGCCTTCAAGTACGATCTTTGCGCGGACACTTGTTTGTC
AAAGTTTTGGTAAACATGCGCCAGAATGACCCAGTAGCGAGCATTCATAGGGTCATTGCGCAGGACCAGATGCAATTTCCCCACTGCAGCCTCGTCGTTT
TGCTCTACTAGGTGCTGAGCCAGTCGTAAAAGTGCCCACGTAGGGGCAGTCTCAGGATTCTCTGTCACTCGCTCCCACAGCTTAACATTCGTTTCGTATT
TCCCTTGCAGATCGTAAAAGTCGCTAAGGGCCATGCCTGCTAGCTCCTCAGTGGGAGACAGCGAAAGTGCTTTCAAGAAACACTTTTCAGCACGCAGAAT
ATCCTTTGCGACTACTTGATACCATTTTCCCAGCCATGAAAAGATTTCCGCGTCAGATGGCGTCAATTTGGCTGCTTGCAGTAGATGACCAAAACATCCA
GTCTTGGCAGTTTGGTGAGACCCGCCGAGGTGCCAGTACATGATTGCCAATCGCTTGAGCGTTCGCCCTCTAACAGATACATCAGTGGGCGGGATTTTGC
TTGCGTTCGTCTCTAGTAGTGCTTGGGCCTGCTGGAGATCGCCAAGCTGAAATTGCAGCCATCCGCGCGTGCACAGTGCAGCAGCACTCATTCTTTCATC
TTCCACTTCAGACAATGAGACAGAGTCAATGATATCGAGAGCCTCCTGTGGTCGAGCTTTTCCGGCTAAAAGCTCTGCTGCTGCAACTGCAGCTCTAATC
GTAAAGGCAACATCGCCACTTTCCATGGCCTTGTGGTAGTGCTCCAGCGCTTTATCTGTTTCGGCAGCATATTCACGTGCTGCTGCTGTCATGAACTGCA
CCTTGACTTCCGAATACCTGTAGCGCACACGTACACAGTAAGCGACGATGTACAATACAGACCTCGTAGCAGGACTTACAGAGCAGGGATCGGGCCTTCG
GATCCAAGCATCATTGTCTTGTCAGCCACCACCTTTTTTGCCAACGCTAGACGATTCAAGCAACCCTCAACGTCGCGAGCTGCAAGAGCGATCGACGCCA
GTTCGACTTGAACGCGAATGCAAAGAGCACATTCTTGAAATGAAGAAGACGAATATCCTGCGAGTGCTTCGACGAAGATTTCTCGAGCCTGGTAAAGATA
GAGGACATTTACAATTATCAAAACCGTGACATCAGGCACGAGCAAAACCAATCTTACCTGGGCGTTTTCCCCCGCATGCAAACACTCGATCGCTTGGAAC
ACAAGGGCCATAGGACTCTTCGGGTGACTTGCAGACAATCGTGCCGCAATCTCCTTTGCCTTTCCCAGCTCAATAGCTGCCGTTCACGAAAGGAATATCA
TTGTGATTAGTATAGTATCAGTCCCACAAATACCAATATTAACGCGTACGAGTGTCCTGGTCTTCAGATCGGAGAAGTAAATATTCCGCTGGGATCTTCG
ATTCAGGAAACCACTCCACGATTGACAGTGCCAACGCATCGATCGTCTTCAGAAGAGTACTTTTCTTCTTTGAAGTCTTCAACGCGTCCAGGTGGAATCG
CATGAAGAATGCAATTGCGACGTCCATTCGCGGCCGAAGTGTGTCAATTTCTTCGTTCTGGGCTGTCCAATCTGTACGAAATGCAGCAGTAAAGAACTGA
CTCGAGATTTCTGCCATGGAGTAGCTACCAGAGCATTCCGATAAATTGAAACCAGGACGCTACACCGCGAACACAACATGGGTTCAACATGTCGCCCATA
GTCTAACTGGACAAAGCGATATCGTACCTGTAGCAAATCAACTAAATCCAGCCAGATACTCAGTGTTGTCGGTAGCTCCTCGTTCGGAGTTTTCTCCAGT
GAAAGCTGCCCCAAATCTCTGGATTGCTCCCCCACGAGTGAGTACCATGAGTCAAAAGCCTGCTCCAGACAATCACAAACCAGCAACAAATAATAAGACT
CGTCATTGTGGAAATATTAGGACAGTGTCGATGAGCACGAGATCAAACCTTCGGGAGCATCTTCAACTCCATCGCAGTAGCTGCCACCTCAGCGACCCAC
TTCTGGCATTTCTTCAACTTCTTGCCCCTGTAAGCACCTCAAACATCAGCAAAATCCTCCTACACTTGTCTCTCGCATCGCAGTACCTTAAATTAATCTC
CACAAGTTTCTGCAGCGGTTCCATTTTGCTCTTGATGTCCTTCTTTGCTTCAAAAAGGTCCACAAGATACTATAGCCACATAAACTCAGTCTCTGCAATC
CAGTAGTCGGCTTAAACGGCGTCTAATTACCTTCCATGGCGCCGGCATGTCCGGCTTGAGATCCGCAGCGCGGCGATACGCCTCCTCGCAGTCTTCCCAC
TACAATCATCAGTTTAATCACGTATACTATCAGGATAGTGATCGTTAATACGTAGGCATCCAAGACAACGCACTTCCTGCAGCTGGAAGCTGGCCAGTCC
CACACACATGAAGGCCTGAAAGTTATTGGGATCGAACTGTGTCACGCGGCGACCAGCGTCCTGTGCCTCCTGGAAACGCTCGGCCTTGAGCGCCGCCGCC
GCGTCCAGCAGCATCTTCTTCAGCATCGCCGCCGACATCTTCGTCTTGTGCCAGAACTTTTTTTGGTTCACAAGTGGGACCGTACGTTATCGTTAAGGTA
TCTTGGTACCGTACGTTTTCGTTCAGGTATCTTGAAATCGAGCTGTTCATTTTAAACAGTACCAGTTCGTTTTAACCGTACAAAGCGTATAACTGAATGG
TCCGATTATACAAGGCGTATATTTTGAATGGTCCGATTATACAGTACATGCACTTTTTAAGTTTCCTTACCCATTTATTTGACTACTGTAGTACCAAAAC
TTGGGTCAAATAAAAAGGGTACAAATACCTATAAAATGGACCAGTTGAACCAGACATTCACTCTTGATCCCATTTGCCAACTTCCCTGTAAGACGATCAT
GTGGAAGGCGGGTGCGACGGCGGCACGACGGACGCTCGCGTCTCCACTGCCTCGGGCTCGGGCCGCTGCTGGGGGCACGCAGCTACTGTGCTGGCGTCCG
CGAGCGTTGCAGACGCTGCCGTTGGGGCTGGGCCGACCTTACTCGACGTCTTCCTCCTCGTCAGCTCCAAGTACGTGGCTTGGTTTTACATTCGAGGGCT
TAAGAGTTAATGAGATCTTTTCGGTTTGATAGCGACGCAGACCGCGCAGATGGCGGCAGCAGCGTTGGCCGCAGCGGGCGTCGGCTACCTGTTTGTGACG
ACAGGGCGTCAGAGCGAGCAGGAGAAGCAACAGCGCGAGCAAGAAATCGAGCGTCAGCGCAAGTTGAGTGACCGTCTCGCCGCGGAGCTGGTGGCGGCCG
AAGCTAACCAGCACAAACTGGACTGGAAGACCACACTCGAACGCGTGGTGCCTGCTATTGTGAGCTTGAAGCTCAACTCGCCCAAGGTGGGATGGAGAAC
GTTGTTATTATGGTGACGTCAGCAATTATTGACTGGGAAATTGGGTGATTGGGTTTTATAGTTTTTCGACACGGAGTCGCCGGGTAACGGGTCCGCGACG
GGTTTTGTGGTGGACGCGGAGAAGGGAATTATTCTGACGAACCGCCACGTCGTGGGACCAGGACCCATTGTATGGAGATAGTTTCGATTGCTGTTGGCTT
TCCGGTTATTGACAATTGTGATGGTATGCTTGGAATTTGTTCGTTTTGTGCAGGATGCGGAGGCTGTTTTCCAGAATAACGAGGAAGTTCGGGTGATTCC
GATTTACCGCGATCCGGTTCACGACTTTGGCTTCTTTCAATTCAACCCGGCGGTAAGTTGTACCTACTCATTGCTTTGCTAGTGTTTTGAGATTGTTGAT
TGACCTGCTTTGTGCCGAACAGGACGTGAAGCACATGTCGGTGCCTTCTTTGCGCTTGGAACCGGAAAAAGCTACCGTAGGGACGGACATCCGCGTCGTG
GGTAACGATGCTGCTGAAAAGCTCGCTATTGCTAGTGGCACACTGGCGCGTCTGGATCGCGATGCACCCAACTATGGATACAACAGCTACAACGACTTCA
ACACCTTCTATTACCAGGCTTCGTCAGGAACTACCGGCGGTTCTTCGGGCTCACCAGTGCTCAACCACGATGGCGATGCAATTGCTCTCAATGCCGGCGG
TAAAATTGGCACAGCAGCATCCTTCTATCTGCCACTAGATCGAGTTAAGCGCGCATTCGATTTAATTCGAGAAGGCAAGGAGGTGCCTCGCGGCACTATC
CAAGCGATCTTCAACTACAAACCCTTCGATGAGGTGCGCCGACTTGGAGTGGACCCAGCCACGGAAGGTCTTGTTCGTACTTCGTTCCCGCTGGAGACAG
GAATGCTAACAGTAGCCGAAACGATTCCGGGTGGCCCGTCCAGCAACAAGCTGCAGCCTGGTGATGTACTGGTGCGCTTAAACGGTGAATTGATCACGCG
GTTCGTGCCATTGGAAGCCATACTTGATGACAACGTCGACAAGGAGGTAGATATTTCATATGCTTATAGCTTCTACCATGCCGACTAATCCCTTGCGCTG
TTGCCACAGGTTGAGCTTCAAATCGAACGTTCAGGGGAGTTGGTGACGCACAAAGTGCAAGTTCAAGACTTACACTCAGTTACTCCATCGCGTTTTATCG
AAATTGGTGGCGCTGTCATCAACCCGCTGTCGTACCAGCAAGCACGGAACCATGCGATGAGCTCTGGAGCGCCGTACGTTGCGGATCCAGGTTACTTCCT
GCAACGTTCTCGTATTGGTCGTGGATCCATCATCCACTCTGTTAATGGTACTAAGACGCCTGATCTCGAGACGCTCAAGAACTACCTAAAGCAGTGCAAG
GACCGCGATCGCATCGTAGTCAAGTTCTCGAAATTGACAGATAAGTCTGAAAAGGTCGAGGTCGTGCATGTAGACCGCAGGTGGTTCCCGTTCTGCGAAT
ATGTACGTGACGACAAGCTTGGAACATGGCACTGTGAGCATTTTGCTCCACCCAGCGAGGATAGTAGCGCAAGTGATGCCGAAAAGAGCAAGACTTCAGC
CCAAGAGGAGCCGATCGGCTCAACAACTACCTTACCGGGTAAAAACCCGGTGGAGAATAAGCTTGCGCGCTCGTTAGTCACGGTGGACTTTGACAGACCA
TTCAGTGTGAACAGTTTGTCGACGTCTAATTACCGAGGCACAGGACTTGTGATTGATGCGGCCAAGGGACTTGTGGTTGTAGATCGCAACACTGTGACTG
ACTCAATGGGCGACGCCATGGTGACTTTCGCTAGCACCATTATGGTTCCGGCTCAAGTGGTATTTGTTCATCCGGTGCATAACTTCGCCATTGTGCAGTA
CGATCCGAAGCTCATTGGTTCCACGCCCATTGAAAGCTGCCAGGTGGCATCCAAACCGCTGGTACCATCCGATCCCGTGTGGCTCGTTGGTCTTATGAGC
AGCGTGGGTCGCAGTGGCCACTCCGATCTTGTGTCCCGCGAGACTATCGTGTCTGGTGTTAAGTGGATTGGATTGCCTATGCCTAACCCACCGCGGTACC
AGGAGCATAACCTCGAAATGGTTTCTTTGCAGGACGTTGTTGGCACTGAAGGCGGCGTTATTTGCAGTGACAAGGGCGAGGTGAGTGCGTTCTGGGCCTC
TTTCTCGTTCCAACAGCAGCGTCGTAGCTCCAAGGTGGAAAGTCAGTTCAACCGCGGTATCCCGATGGATCTGATCATGGAAAGCGCTGCACCTCTGATG
CGTGGAGTGACACCTAAAATCTACGACCTGGGCGTTGACTTCGAGCACTTGAGCTTGGCTAAGGCTCGAGAGCTTGGTCTCGGTCAAGCTCTAGCCGAGA
TCCTGGAGAAGGATGCGCCGGATCGCCGGACCATTTTGAGCGTCGCGCGACGATGGGGTGGCACCGAGGCCCAGGACGTGCTTAAAAACGGCGATATCTT
GGTCGCTGTGGACGGCAAGATCGTGACGAGTTTCCGTGAGGTAGAGCGCTGTACACAGAAGCCAGAAGTGCGGCTCACTATCGTGCGAGATGGACGCGAG
ATGCAGTTGGACGTGAAGACCCTTTTCATGGAGCGCACGGAGATCAACCGTATCGTATTCTGGCAAGGTTTGTTACTGCAGGCGCCACCGCTATCAGTGT
CCGCGCAGCGTAGCATCTCGTTGGATGATGGTATATACGTGTCCTGTCGGTACTCGGGTTCTCCGGCTGCTCGTTATGGTCCGCCACCCACAAGTCGCAT
CAAGGAAATCGACGGCATCAAGATCACAAGTATCGACGATTTCTTGAGTGTCGTTACCGCAAAATCGGCAAACGACTCGGTGCGCATCAAGTACACGGAC
CTCAGTGGCAAGGACCGTCTCAGTACGCTCAAGCTCGAACCCAAGTACTGGCCTACGAGTGAGTTGGTGCATGAAGGCGGGGAGTGGCATCGACTCCAAC
ATTAAACGGGGGGTCACTCTTGTCTTCCAATAACCGTCAAAAAAAAAAAAAAAAAAAAAATCGAGTTTGTCGCTTTGCCGTTGAATGCCATCCCGACCAA
TCAGCATGCGTGACGACGAGATTTTGGAACTATGTGTTATTAGGCCGCCCTCCTCGCGGAGCCAATCAGGATGCGTATCGATCCCTCCCGGGAGCCAATC
AGGATGCGCGTATCGAGACGAGATTTTAAGAAACTAAGTTTATTACTTAGTTCTAATATTTAACGACTCTTCAGAATCTGAAACCATTCTAATTTAGTTC
CCGGAATTAGAACGAGATTAAAATTCCGAACTAATGTTACTTCATTCTTCAAAAATAGAAGCTCAAAATGGACACTCCGCCGAGCATCCGCCGGCAATAT
GCATCACCTCCGCGTGAGTCGCCCGAGGGGCGTCGACGGCGACTGGCCAACCGGCGTGCAGCCAAGTACCGCCACTTCAAGTCCTTGTCCAGCGCATCCC
ATCCCTTAGTTGAGCTACAGCGCCAGCAGAGCACACGCCGACAACGCGAACGCCGTTTGCTGCTGGACGACGAAGCACGCGACCGCCTACGTGCACAGAA
CCGGCGACGACAACAGCTTCGACGCCAGAATCTCAGCGACCGAGCCAAGGCAGATATCCGCCAGAAACAACGCGAGCGACAGCGTGAGCGTCGCCATACG
CTCAACGACGAGGCGCGCGAGGAGTTGCGGGCGCGCGAACGCTTGCGCATCCGATGCCGTCGACGCCAGCTCAAAAGACAACATGAGGTGGATGAGGAGG
ACACACTACTGCCCGCGCAGTTGCAACTGCTGCAGCCTGTGTTGGACAGGGACCGACTGCCGCACTTAAGGCTGGCGCCGGAGCTGCCGACGTTGAGACA
GCATCAGGAACAGCAGAGACAGCGAGAGATGCAGAACAGGTTGCCGTTCGGTGGCGGTGTACAGATCACATTACCCCCGCCGCCGCCTATTGAGAGAGTC
AGGACCTACCAGCACGAACGGATCCCGTCGCTGCCTCATTTACAGCAGGTGACGAGGCCCACGACGTCCTCGTTGCTGCATACAACCCCTCCACCGCCGC
TATTCTCGATACCAGGACCAGGAAGTGCCACATCCGCGGGGTTGCCTACAGTTGCTAGTGCTGTTGCAGCGGCAGCCACCAGACCTCCCCATCCTACGCC
GATCATGCCGTCCGTCAGCTTGCCACTGCCCAACAAACCGCTGGCTGCACTGCCGCTGGTTCAACAGCAACAACAGCCACCGCGTACACCGATCGTGCTG
CCACCAGCACATCGTTCACTTCCGCCGTTACCGGACTTTCTTAACAGCCGCGAAGCGTTCAACCCCGCCACTGCTGCAGCTGCTACTTCGACGCGGGCGT
CACGGCCATCAAGTACTGCTAGCAGAGCGCTGTTTCCGTCTATTACTGACCTTCCTGCCACTCACACGGATGTCCAAGACGCGGATTCATATTTTCAACG
ATGAGAAAGATCAGAGTAGAGCGATATTATGAGTTTGGAGAAGCCGTTGGAGAGCTATCGTTCCTGCTTCCAGCGTTGCAAGGTATCTTACCGTAGAAGA
CTGTCGAGTTTATTGACGCTTCCCTTCGTTAGTGGACGATGCGGAGCGTTAACGTGCCAGAGAGCTCGAAAAGCTTCATGTGCGTACGCGCCGCGGTTTG
CCAAAAGAAACATTTCAAGTTGCATCTCCGACAAGTTCAACAGCTGGTAGTACCGCTTGGCGTCCTCCAAACGTGAAGCCAACGAACAAGATGAAGGCAT
CGATGTCGAGGAGGACAACGACATACCATCGCGAGGATACGAGTACAACGTGCCCGTGAGCCCTTGACGAAGAGCCCCGATGTTGAGCAGCATCTGCTGG
ACACCTCCACGAGTAAATGTACAGTCAGTCATCTGAGCAAGATTGCCGATCAGCAGTCGGGACAGCAGCGAATCCACTCCATTGAAAACAAGCGTCATCT
TGTCGCTCGCCAAGTACGGCTGCAGTGCGTTCTCGATCGATGAGAGGTCCAAGTTGAGCGTCAGTACGCTGTCTTGGGCCATGGTCGGCTGGCCTTCTTC
CAGGTCAAATCGCAGCGAGACGAGCTGTGTGAGGTAGTAGCAGCAGTGCAGGCGCACCTCGCGACGCAGGAACAACAGACATTCATCAGCTAGAGCACTA
CACTGCCAGCTCGCAGCTTGTAGCGCCATGGTAAGTGCTGGTGAGGTAGCTGGGGCTGCAGGAGTGTTGTTAGACCCTTCGGTACCTCCTGCTACTCGTT
GGAGGTATACAGCGATGAGATCGCACGCGCTGTTGGCGTAGCCGAGCATCCCAATTCGCGCGTTGTCCATGAGTAAACCATTGGGACCTTGCATCCAGAA
ATCTGGATCGTAAAGCTCACATTCAAACTCCAGTTCTCTTGCCGCTATCATCTCCTCAGTGCTCAACCGGTTGGGACCAGATCCACTACTCGTCGATCCT
GTTGGCTGCACTTTCGAGTGGTGATAAGGGATCGGACTGCCTTGCTTGGCGCGTTGATATCCTTCGTACTCGTGGAAAATGGCTACCAGGTCTGCGCAGG
TGATGTTTTTAGTTAACAACTGCTGGTGATTGAGCGTCTGCTCACGAATATCGCGCACTATTACAGCGCATTCTTCCAGCCAGCTGAGCACAGAAGCTTC