Description :
From Genome Similarity Track
Location :
Scaffold_870:5087- 7578
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_870-snap-gene-0.10Flagellar protein
Pytap_DAOMBR444maker-pag1_scaffold_870-snap-gene-0.8Conserved gene of unknown function

Sequence
2491 bases(100 bases per row)
TAATTCCCCAACCACGCGCGCGTGGGTGAGCTGAGAGTGCTGATTCAGAGCCTCCTGAAGAAACCTCTTGCGTCGGCGCTCAAATAACTCGCGGCGACGA
TCTCGGTGATGCTTTTGCTCACGAATGGTAGTTTtGTTGGACTTCAAATCGGGGTTTGGCTGTCCCAGTACGACcGGCTTGTTCGGGTCTTTGAAAGCGG
AGGCACTGCCATGCATTGCATGTTGCGTTTCAAGAGCACTGCTCAAAGACCGCAGGCCGTAACCAGCtGACTTGAAAGACCCTTTTGAACTGGCTGCATT
AGTTACTCTCGAACCTGAAGAACCACGCTGCTACTTTGCCAATTAGACACTACTATTGGACAgTTTACGTCGCCCCACTTACCTCGAAGTCGTCCAAATC
TCTCTCCACAGTCTGACGGAGGCTAAATGCAcGTTCCTGTTGCTGTTTtGCTTTCGCTGCTGCGAGCTGCTGATAGAAATGCGCTTTTCGTCTCTCACGC
TCGCTTTTCTTTTGCAAAGCTAGTCGCCACGCCGGCGAATCGGTCTCATCAAGAGCTGTCTTGATGTACTCGCTgTGCAGAAACGCTTGATGCAGTCGCT
CAGCTTTCGTGATTTCTAGTtGCTCCTGTATGCGCTCTTGTTGTTCCCTATAGGCAGCCATCCTGCGTTTCTCCACaTCTATTGCATCCCTGCACACCAT
CCATGTCACGAACAGTCGACAaTTtAACCAGAACTACTTTGACTTACCGTTCtCGTTTGAGCTCTCGAAGAGACTTGACGCGACGACGCACCGAGTGCTC
GAAGAAGTAGTGATTCGCTGCGTCGTACGCTGGTTTGGGGAGTTTGCTTGGCATATTGTGTAGCGGAAGGATGTTGGCTCGTTCGACAGACTTGGTGGAG
ACTGGTGGTGCGCGGGCAAGACGCTCAGCTGCCATCTTGATTTCGTGCAATATGTTGGtGGCTGCGTCGCGCTTcgTGTTCATGATGGCTGTGGCTACTT
TGGAATCAAACTTGATGCCCACGTGGCGCATCGTCGGCTCCAGCAGGCAAAAaTTGATGATCTTGGCATCCGCAATGGCGCTGTCCATGAAGTCGGCGAA
GTTGTGCTGCTGGTTCAGGCGATGCATGATCTCGCCGAGTAGATATCCACTCGCAAAGTCCGCCTCGATGTCTGTCACATGCTTGGAGAGCTGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNACCTACaaTtGCTCCGCGCATTCtCTCACAAGCGCTGCAaCGAaGAGCTTGCACCGcGCCCTACGTAgcAGCAAGCGGAGC
TCGTGGATGACCAAGAGTTCCGAGGTTAGACCACTACCTcTCCCCCcACTTGGAAATCCaCCGTAAAaTCCGCaaCcTACCCCGTGtcGCGCAACTGCTC
tGACTCACTTGCCCAGTGTTCTGAGCACCATCTGTCCCCGTCCaTTCCTCCATCCATACCTCCGTTTCCACTGTTAaTGAGCGCCAACACGCCAAGTGCA
AGTGCACGGGCAACTGGAAGGATGACCTCCAACGCCGCCCACCGCCAGCCTCGTGCCGACAAGAAGCtCATGAAGCGTCAGTTGTCCGGCTACGAGTCGT
CCTCGCCTGAGGACGAGGAAGAAGATGAGACGTTCCTTGCGCTGCAGAGACTGCTGAAGGCGCTCAATAGCACGCGTCAGAGCGCGACACAAGTCGTTCC
AGTGCCTTCCGCTCCAGCAAGCGAGCCCAGCGCGACCACAATGCCGCAACCCATTAGCGCGAGCGCCCCtcATCACAGCAACAGATTGTCA