Description :
From Genome Similarity Track
Location :
Scaffold_442:5086- 8685
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_442-snap-gene-0.12C2 domain-containing protein
Pytap_DAOMBR444maker-pag1_scaffold_442-fgenesh-gene-0.4Conserved gene of unknown function

Sequence
3599 bases(100 bases per row)
TGGGCGTGTGTGCGAACTTGGAGACAGGCAATGACAGCGTACCGAGCAGATCATGGGCGCTCAGGGTATCGTAGTCGTACACGAGCACACGCAGCACGTC
ACTCTGTGGGCAAGTCACGGGAAATTCGAAGCATTCGCGCGGGTGCCATGTCGGGTTGAGCTGCTGATGGACGCATGTGCTCTGTTGGGTCTCCTTgCCG
ACCTGGAAGAGCACGAACGGGTCGCTTTGAGAGCCTTCGAGTCCGGCGTCGCTCACGGGCAAGTCGCTcGCCcGCAGCAGCGTCACGCGCAGCGTCGCCA
TCGATTCGAAAaTaCAACCCgCGCCTTGAGACGAGCGGGCGCTGCACGCATGCTACTCGGTGGgTTCGCGATCAGATCCATGAGACAGCGACTGTTCATG
ATCCACGCCTGCTTATAGCATCGCATGTGAGGGCAGAATTAGCCACGCACtcTACCTGCATCCAGTGGATCAAGAAGATATGCTCGTATATCAATGCGTC
ATGGTTACTAGAATGCTATGATCCGCGAGCTCGTCGATGTCGATGTCAATGTTGATATTCATGGTGTCGGAGTCGACaGCTTCTTCTTCAGTCGTATCCT
GCaTGAATGCCTccAAGaGCGGGATTCCGtCGTCCACGCCGTCTTTAGGaGgTTGTGTAGGGAAGGCTGAGTTGCGGgCAAaGCGCATTGACATTTTACT
TGCACTTGATAAGGCATCCGAGAACTCGGTCGACGTCCGACTCGAAGCCGAGAAGTAGCCTCTTTCATCAGTGCTTGTTTGCTTTGGCATCGCGCcTTCA
CCTGAGTACGCTGCGTCATGGATCCGCAGTGTCGTGGTCCAGTCGTGTGTGAAGACACTGCTGCTTCTGTCACACGAGTTGGCAACTGCGGCCACCGAGT
CGCCATCGATAGAATGAAGCACATCGACAACGCACGTCTTGCACCAGTGCACTCGAGCATGCTGCCGCGATTTGTGGTCCTGCACGCAGGGCTTCAGCAT
GGAACACGCCTCGCACACTGGgTTCCCGCAAGCCGCACACAGCTTCAaCCGCCGCCACTTGATCCACCTCTGCTGTCGATGGCAGATCGAACATCCGTCT
AACTGAGGAGccATCGTTGTGATATCATCTCCCAATGTGCCGACGCTCACATCTCGCACGCGAAGCGCCTCACCATGCTCCAAGAACCGAGCGATGGCTT
CAGGAACGCGACGGGCTGATgaTAATGGAAGTTCTCCGATGCCAGACACTTCCACGACTCCATGGCGGCGCTGTtGAAACACTACACCGAACCACCACGC
cTTGTTGGAGGACTGCACAATCAAATAAATACTCTCAaGGcctcccGAGAGGAAGCCGGTCGTTGCAATGCACAAGGCGGATCTAGACGGTGTTCTGCTG
AATGCTTTCCGCTTCCGACTCACTTGATACTGCCTTGAGTTGACcTGACCGACCgTCGTCTCGAGGGAGCTCGCCTCAAGACCTCCACGAGACACAAACG
ACGCCATGGCCGAGAACTCTTCGTCACTTGTTCGTGcAATCAACTCGATTGCATCTCTTGCACGCCCAGAACATACACCGCTCACACGATGCTGACGGGt
CGTTGTGTCATTCTTGCTCCACAAGCGCCCTCGTCGATGGTCTCGCCGGTCATataGATGCAGGTTTTCGAACCGAGTCATCATCCTCCACGTGGAGtGA
TCCTCGCTTTCAGTCCTAAGGCAATGCGCCTGCAGCCGTCGGAGCAGCAACTCGTAAGTCCTGTTGGGCATGGCAAAGCACGAAATCGACAATGGTAAGT
CTCTTGGACGTGCGAAAGCTAGGagTCGGAGTCCGACGTATGGCGGTTGCAGTGGCTAACGCACCTGCGTCGTTGACCAACTACCGATCGCTCATCTGCT
CAGCTCAGCTGCCCGCAGCTGGCTGCACCATCCTTTGTGCCCCTAGAAACGCGTTCGTAGCCACCTGAGTCGAACTGTATAAGGCACCACATGCTCCACG
GCGACATCCTTTACCGAACACGCTGACTTTCTTCACTAAATATGGCTATAATGCTGAGACTATGCCTCCTGGCTCGACTTGTGAGACGCAATCTTATCTT
CTGCGCGTGGAGCCTGTGGAGCGCCCACATGCTGcGCCTTAGCAGTCTGGTACGTTTGCTCGGCGAGTTGAGTGAGCTGGTGCATCCGGAGATAGAGCTG
CATCTGGTGTTCGTACACAGCGtCCGGCGTCATCCTGTGtAATTtCGGCTGAGGATTGTGGAGGTGCCGAGCGTCTGCCGCAGAAGCTCCAGCTGACTCG
CTGGTCTCACCCACGACATGGATGAGGTCGGcGCTGTCCACTGAGATCCGGGACgaCAGGTCAGCAGTGTCCAGAGAGAATCGCGAAAGCACGTGGCTCA
CATCTTCCGGGTCGTTTTCTGCCGTCAGCgCCGACGATGTTACCGAGAGTGAAGAAATCAAGCGctCTCGAGtGCTGTTGACTTCACTGGAAGGCtGGTC
cgAGGTGACGGTGGAAGCGACGCTGGCTGATCGCaTGTGCTGACGCGACGTGGGGACGGTGAGGTCACTAGCGTTGGACGACGAAGCTGACAACGATGAA
GACCGCATCTTATTGGTCCACCCTGGGGCTTCAGGACGAAGCCTGGCCGCATTGTATGCGCACGTCTGGCAGCAGCTCACCTTCTCGAAGCGTCCTGCGG
TAGGAGTGGCCTTCCGACCGAGATCCGGAGCGACGACGAAGATGCGACGGTTCTCCCGACACTTGTTGCAGATCGTCGTACCACATACCTCGCATTCGGT
GAGCGAGATCGTATTGAAAACCTTCTTCTCCTGACGACACATGGAACAGAGCACCGCCTCTTCGTGGTAGGCAAAGGTGCTGGCACGGAGACGCTGGCTC
GATCGGATCCGTCGGCATTCTTCGATGAGAACGGTTAGCCGCTTGGTCTCACCACAATTGACAGTACTACCGGCAATCGATAGCAACGAATCGGACGAGA
ACACGGCACCGCCGCTACTCGAAgaCGACGAACTACGtAGCAAGCCACGTCCTGACACCGCATCGATGCGGGCACGCATGAAGACCTCGATGCCTGTGTC
GTTCATCTGCCGGAAGAGCGTGCAAAgtGTCTGTCCTGGTGCGCTACGGACACACTGTCGGCTTTGGAACTCGGGGAACGACGGCAGTTCGATGGTCTGG
AGCACGTGGAATCCGATGTCCTTCCCATACTTCGTCCTTGTTGAGCCACTGTACTCAAGATACACGACGTCACGCAGTCTTCCAGACGCCTGCTTGACGA
ACCACTTGTAACTGAGAGCGCAGTAGGGGTCTTCGTCTCTTGAACTCACAAGCGTCTTGAGGATGGCCGAGTCCGCCACGTCTTCGAACAGGAATCGAGT
GAGCAACGCGTGCTCTGTTTGGCCGaCGCACGATAGGGCATACAGCACATCTTCGACGCGgCCTGTCGTCTCGCCTGTGAGAAACCATTCGCTAGACGTg
aTTCTCTTATCGCTCGATGTCTTGCGCTCCTTGAACAGCTTGAGTTGGTCCTTGCCTGCGTCCAGCTTCCACCGcTTCGTATCGATGTAgCGTCGATCA