Description :
From Genome Similarity Track
Location :
Scaffold_156:50854- 55836
Transcript NameFunction/comments
Phypl_g4380NADH dehydrogenase
Phypl_g4381hypothetical protein PHYSODRAFT_354944
Phypl_g4382hypothetical protein PHYSODRAFT_561927
Phypl_g4383hypothetical protein

Sequence
4982 bases(100 bases per row)
GCTCCCCGACGAGCCTCAAACTCCTCCATTCATTTGCTCTTATTTTCTTTGTTATAAAGGCACCCCACTCGTGTACCCCAGCGAGGCAAGGCAGTCAGGC
GAGGCTGATGCTACAAGCTTAATCCAATCCACGCCCCGCTGAACACCCCGTCGAGGACCCGATCTCACTGCTCGCAGATTGCAGGGCCCCTCTGTGTGTC
TGTGCCTGCTTAACGGTAGAGCTGCTCGACCGAGAGGTTCTTGGCAATCTCGAACTCCCACTTGTCGCCATTagccagcagcttggccttgtcgtACAGT
AGCTCCTCGTGGCTCTCGGTGGCGAACTCAAAGTTGGGGccctcgacgatggcgtccacGGGGCACGCCTCCTGGCAGAAGCCGCAGTAGATGCACTTGG
TCATGTCAATGTCGTAGCGAGTGGTACGTCgcgcgccgtccgcgcgcGGCTCCTGCACAAAgtcaacagcagcggcacgaacACTCATCAGCCCCACTTC
TCCATGCGAAGATCCGTTTAACACTCTAGTCACGCACCGCTTCAATGGTGATGGCCTGCGCAGGGCAGATAGCTTCGCACAGCTTGCAGGCAATGCATCT
GCAATGGCAAATAACAATAGCAGGCATAAAGGATGAGAACGCGACTCTTCCGACGTCTGGCCGGACCACCAGAACGGGATTCGTTCACTCACCGCTCCTC
GCCGCTCGGGTAGcgacgcagcgcgtgctcgccGCGGAAGCGCGGGCTGAGCATGCCCTTCTCATATGGGTAGTTGATGGTGACCTTGCGCTCCACGTGC
ACCTCCCAGGACAGCCAGGTGGCGCGGAACACGtccgagaggaagaaggtGTCGGACATCTTCTCGATCACCTCGCCCCACGTGGGCTTGGGGTCCAGCT
GGCCTGGAGGAGGCACGTTCGCGaagccgcgcgcgctgccggccgccgcggcgggCGCTGTGCGGCTCAGGCTCTgcttggcggccacggccgcggccga
TCGACGCAGCATCACGACGTTCATGGCGCGTTCCGGTAGTGtggggagcagcagcgagagccTCTCGTCGTCTGAAGTAAAAGTAGCGCTTAAGTCGCTC
GGACGCGACTTAAGCGCTACGTTTACCACCATGTATCGGAATAATGGCAGCATGGACACTCACTGGAAGCGGGGCCGCCATTTAGAACCGTGTTGGCGTC
AAAGGGACCCGACCAGCGCatgccaagcagcagcagaatggTGTCGAACGCGTTCGTGCTGTGCAAGGTGCGGCATAGCGTGAGTCTGTCGCCGTGCCAC
GCCGCGGACGCGCGCGTGGGCATCGAGCAGGACCTGACGGAGCAGCTCATGCGGTACtcggagccgctgcagggcgtggtgctgagcttcagccgcgtgc
agctggaccGGCCCTACGGCGCCATCGTGAACGAGATGCCGTTCATCCACTGCAAGGTTctggccgacgcgctggtcTTCCGCCCCCAGGAGGGCATgcg
gctgcgcggcgtcgtcaaCAAGATCGGCAGCAACCACGTCGGCATGCTCTTCGCCGGCGTCTTCAACGGCTCCGTgggcgaggccgagctgcccAAGGGC
TACGTGCACAACTACGCCCAGGACTGCTGGTACGAtggccgccgctgctgctatGTTGGATTGTTATTGACGCTGTGTGCGCTCTGTAATTGGTCATGCA
GgctgggcgaggacggctccaccatctccgtggaggacgaggtcgaggtgaaggtgctgcggTGAGTGAACTGCTTCGTTGCAAACTATTCTTCGAtcgc
agcgcgtggtgctgacgcAGGTGTTTGTTGCCGTTGAGTAGGGTCCACGTTGCTGGCGGCATGGTCGCCATTGAAGCCACCATGCGCtttgacggcgctg
gcgtcgtgaAGCCCACCTCGACGAAGaaagtgaagaaggccacgcaTCTTAACCTGTCCGCTGGAGAGTCGGCGACCAAGCCGGTTAAGGAaaagaagga
caagaagagcaagaagcgcaagcacgaAAAGCCCGCCGAGGAGGTGGTAGAAGTGGAGGCAGCGCCCGTCgaagaggtggaggaggaagtcGAGGCGAAA
CCTaagaagcacaagcacaagcacaagcacaaggacaaggacgccaagaaaaagaaaaagCACAAGAGCAAGCACGACTAGACCGACAGGAACGTGGGCG
CTTGGTGAGACGATAGATGGATGCCAGGTATCCAGCTGCATGTGTTTATATACTTTCAAGAGCACTTGTCTTGCGATCTCTCTTCGATCTGGGCACGCAC
GCCAAGCAAGCGCTCGCCATTAAATATGCCACCGGCAGTGCTATGCGACTCGAACTTAGTCATACGAAATCAGCTTCTCCAACTCTGCCGGGATCTTCGG
CAGTGGCTGCTTCGGGTCGCGGATGCTCCAGTTCGGAGACTGCTGCGCCTTGTGCCACTTGAAGTCGTTCACTTTAGCCCAGAGACCCGAGTCCTTCGAC
AAGCCCAGGcgttccagctgcgccttgaGACCATCAAACTGAAGGCGGTACGGCCCGAACTGCATCTGCTGGCAGTCTTCAATAATGGGGTGACTCGGGA
TGCGGAGGTGGAAGGTCGTTGCCATGCTCAAGtgaacgcgcagctggcggcaTGCGACGAAAAACTCGCAGCCGTTGCTGTTCTCAAGCCACAAGCTGCC
GAAGATCGCCCCAGTGTAGAACACACAGTTCTTCAGTGCATCACCGCGGATGGCCGATGTCTCCACGCCAACGAGCACGACGCAGTTGGTCAGGCGCGAG
AAGTTCAGGTCGCGACGCTTGCTGTCGTCTGCGTCGGCAAAGCTGCTGCTATCGATGACAATGACCTCGTTCTGTTTGTTGGCATGCACCATCTCGTCAA
ACTCCATCGCCCTTTGTATAGTCGATGGGGACTGCAGATTGCCAGCAGAGTCGGCCGCAGAAGACAACGCGTCTTGTTCTGGCTGgtcctgcgtctccac
cgcctTGGCCTTTGCTTTTCTCGCTGCATGAGCTCGGAACGTGAACTTCTTCCTCGGAGCAAACGTCACGCGCGTAGTATCAAtcagttccagcagcttc
gacagaATCAGCTGCGTGTGGCGAGTGTCATACGGCGACAAGtacagcgacgccgccgttgccgcAGCGTCTCTCATAGCGTTCACCTCGAGAACCAGCG
CGTCCAGTTTAACTTCCTTGGCCTTTTCACACGGCAgcggctgcttcttctgctcgcaGAACAGCCCCACCTGCTTGCGCACGTGCTCCTCTTGCTGCGT
AAACTTCCCCCAGAACGCCGTTGCCAGCTCATCGGTCGTAAGCtcccgctgcagcttcgagtggtCGCCAGCCGCCGCACTCCTCGcgccctgcttctcc
ttgcgcCGCCCCTCCAGCGCGTGCGTCAGACTCTCTTCGTGCGTCGTTAGTAGGGGAAACTCGCCCATGGTGTTGACCCTCCCCGGACGCACGATGGCGC
CGTGCAGCGGCTTGCAGTCGAAGTAGCGCTTGCCCTGGAACGACCCGTCGCCTTTGCCCAGCGGTTTATCCAGCCGCACGCCCAGCCAGCCGTCGTCCGG
GAGGCCCTCGATCGACCCAACGTACGCGATATTTCCGTAGCGCTTGATGCTGGCGCGCAGACTGCCATTGGGCCCTGACGACAGCAGTTCGCAGCGCGTT
CCGATCGCCAGcggcgtctccatctcggcaGTCGTTTGCGGCGCTTCCTGGACAATGGCTGCGATAAAAACGACCCCCCTCGGATTGGCTGATTTGTGAC
GGGTTATCTGCCAGTCACCGCTCGGTATTTGCGGTGTAGGTACGAAGTGACTGGCGGTACAAAACGCTCATTCACCGTAGGGTTGAGGTGATAGGAGGGG
GTGAAACAGAACTCGCTCACAACGCCTGCGGTTTAAgatccgtgtgcggagcacgcggtcATGGTCAGGTCCAGCTCAGCTTAGTGATCTATCGCCGTTC
TCACGGTTTTCAGAGGGTTTAGCTGGGCAATAGTTTCCTGTCGACACCTCCATCGGTGGAGATTTGGCGGCGATGACATCCATCCTCAGCGGTCGCGCAT
AATTGAATACCTCAACTGTCCAATCTAGAAACGAGCGAAATAGGGAGGGTTTATTAACTTTCAGTGGCAAACGCCGAAAACATCGTGTAGTGCGGGAATG
TGCAGATAGTATTGACAGCGTTcactggctgctgccaccgaaTGTGGCGTGGACCACGCATCGAGTATATCTCTCCGACGGTACGACACTTCGATCTCGG
CGACGGCCCGCAAGCGCAGCGAAGCTCCCAGTCCAAGCCAAGATGTACCCCGGAGGCCAGCCCCCGCAAGGGTACCCGCAGCAGCCGGGCTACCCCCCGC
AGCAGCCGGGCTACCCCCCGCAGCAGCCGGGCTACcccccgcagcagcagggctACCCGCCGCAACAGCAAGGCTACCCGCCGCAGCAATACCCGCAACA
GCAAGGCTACCCGCCGCAGCAATACCCGCCGCAACAAGGCTACCCCCCGCAACAAGGCTACCCCCCGCAGCAAGGCTACCCCCCGCAGCCCGGTTACCCC
GCACAACACGGATATCCCGCCGCGCACGGCCACCATTCCCCGCAGCCCGGCTACGCGTACGGCCAGCCGGCCTACGTGGCCCAGCCCGGCGTGGTGATCG
CTGGTGGCAAGATGAAGCACGGCAAATACAAGCACGGCAAGCACAAGGGCCACAAGTTCAAGGGCCACAAGTACAAGGGCAAAGGCTTCAAGAAGATGgg
caagaagatgaagaaaaTGTTCAAGTAAGCGTGCTCGGGCGTAAAGAGGTCAGGAAGATTGGGGCTGACTGCGGAAAGTGTCCGGCGGTGTCGCCCTGCG
TAGTGTAAACAGCACAAGTTCGCGATTTGCTTTCGGTTAACGGAGAAAATGGCTAGCAACCCCCACGCTGTCGTTGATCGAG