Description :
From Genome Similarity Track
Location :
Scaffold_60:50853- 53103
Transcript NameFunction/comments
Phyci_229271conserved unknown protein

Sequence
2250 bases(100 bases per row)
CCATCGGTAAGGACCTTCCAGTACCCATAAAGCTCCGCTTTGTAGTTGGCTGTGTACAATAGTTGAAACATGGGCAGGTTCACAAGTACTTGACGCAAAG
CATCCCACTGGTAACAGCGCTTGAGATGCCATGGTAGTTCTTCGACACGGCGGAAAGTAGTAGGGTGAATGCGAAAGAAACGAATGAGCCACTGGTGATA
TTGCTGCTCAGCGCGCTCGCTGCCGATGTATCGCCACCAAATGACGTCGCGCAGTATGTCTTTGCACAATGGTAACACCACTACCTCTTGGACGAAAAGC
ACACTCAGCGTGCGTAGCGCGCGTAAGAGAGCTTGCCACTCGTCCTCTGAAAAAGCTGTGAGAAGCTGCTGCCCCATGCTTGATTTTCCGGCTGGGTGAT
CAAATGCTGTACCTTCATCATCTCGGTTATCTCGATGGCGATGAATACCTCGTGACTCGGTTACTATGGCATTGAGAATGAAACGCAGTTCATTCAACAG
TAATCCGTGACGACTGACATAGAGAAGGCACAGTGCTCGCCCAAGTAGTTCCCCAAGTGGCGCCACAGTGCGTCCGCCCGTCAGATAGTCTGGCCTATTA
CCAAGTTTGTTGAGAGCTCCTTGCTTACTCCCTCTGGGCTCTGTAGGAAATCGTTTCAACTTGTGGTGCGCAGCTTCCAGCATCGAGCTGACTGCAGAAG
AGTTCTTGGTAGACGAAAACGATTCATGAGATTGCGAAGCTGGACCACTATCCACCGTTGACTGTACTCGAGACCCGTCGGCGCGTGCCATATTCACGAA
CAGTTCTTTGGTCTCGTGCACACTTTTCATTCGTTTCATCTCGTTTGTCCCCGAAGGCGAGGCGCGGCCATCATCTTCACGTGGGCGAAAAGCAAGAGGG
CGCAGAGAGTCATTGCTCTCACGAACTGCAGCCTCTGCAGCAGCACGTGCTATCTCAATTCTTGTCCGACTGTCGTTGTGGTGCAGTGAATATCGGCGAC
CAGAAATCTGGGCAAGCTGGGAGTCCGCCCCGGACGTTTTTCGAATGGAAGGTGAGCTCGCGATGGATGCTGGATCTCCCGCAGGACTACGACTGGCACC
GTCACCATCGTACTCTAACAAGAATTGCATAGCGTCGTCTGTCGAGAGTTGGTCAGGTGTGTAGCCAGCTTCCATGCTGCGAAGTATCGACTCCAGCAAC
TGGCCTACAGTTTCAGCGGCAAGCCAGCTTTCGAAGACCGTGTGAATGTTAAACCCCTCCTTCACTGCCCAGAGCATGCCTACGAGAAATTTTTTCAAAA
AGTGCGGGCTCGCACTCATTGCCACACCAACGATGGCATTCTGTTGAATTTCAAAGAGCTGAAGCCCCATTTTTCTTGGAGATCCGTCATCGTCCTGGTC
GCTGTCCGAATTTTTAGTAATGAACTGTTGAACGATGCGTCGTCGATCCTCTTCGACCAGTGGGAGAACATGGATGAGCTTCCAATTGCGACGACCGGCC
TCAACTTTAATCCTTTCGATCATTTGAGCACTGAGACTGGTCTTTTCGTAGTAATCGCCTCCAACCCCGCACTCATTGTGCTCCCCTTCATCACCACGCG
GCACTGTGTGAGCAGGTGAACCTGGCCCATTGTAGTTAACTAAAACGTGGGATAACTTAGCAGTGGGGTAATTGAGAGTCCCTGAAAAGATAATGCGAAC
GTTGGGCGGAAAGGATAGCGGGACCCACTTCAAGATGCTCTCACCGTTGTTTGTATGCAGTCGGTGTAACCCATCGACCACAATGATAACACGACCTTTC
TTGGAGGCAGACTCCAAGAATCGGGGAAATTGCCAACTTAGACGCTCTTCCACATCCGGGATCTCTTTGGTGAGCTCGAAGTACTCCTTGATCTCTCGCA
GAATGCGCTCGAGCAGGTTCGATACAGAGCAGGATTGCCGTGAACACCCCACCACATGTGCGAAGATGAACTCGGGATACGAGGACTGCCAGTTCTGGAA
CATTTTCTTTCGACGCACAACCCAGTTCGCCAGGAAAGCACTCTTCCCCATTCCACTCTCCCCCAGCAGAATCACGGGGCCTTTAGGTGTATGCATCGAG
TCGACGTCGCAGAATTCGTCGAGCTCACGCGTCAGTCGGGGGTCTTCATGGTACACGAAGTCGCCTGTTTTGAGTCGCAGCCGCATGAAGCCATGGTGGA
AGGCACTCTCCAAATATGACACGGAGTCCCAGCATTCGCTGTTGTTGATG