Description :
From Genome Similarity Track
Location :
contig_22:508525- 516578
Transcript NameFunction/comments
g4806.t1hypothetical protein

Sequence
8053 bases(100 bases per row)
GTCGTACGGAAATCGATTTCTGCATTCGGGTGCAGTCCGAAGGCCAGCGGCGAGTCCGTCTTGAAGCTCCGTCTCGATGTGCTCCAGGTACTTGTCATAG
GACGAAGGTGCAAGGCACATGAAGGACGGACCCTTTTCATCGCCGACAAAAGGGAACATCTCCATCTCGTCCAGCAGCTCGTCGCGCATGTAGAAGTCCA
GGTACGTGTTGGCTAGCAGCCGATCGAAGTCGTTCACAATATGCCGCCGTACATGATCTCACCGAAGATGTAGCGAAGATCGGCCCACGGGATCTTGCGC
CTGCTGAGCTTTCGAGGTAGTTTGCAGACAGATAGCGGAGTCGCGCAGGTCTCGAGAGCGAGAAGGGGTACATCATGTTGAAGCCCAGAGGGCCGTACAT
CTTGCGCTCCATGAGCACGGCGTGGAAGTGGCAGAGGCCGAACAAAATGGATTTGACCTTGCCTTCAGCCTCCTCGATGTACTCCTTGGCAAAGCTCACC
GAAGGCTCGCTTCAAGTTGGCCTTGAGACCGGACGGCGGCTCGTTTGTCAGCTTGATGCAGCGGTTGAGCACGCCGATGGGGATGGAGTTGGACGGGTCC
GACGTCAGGAACAAGCGGAAGTTCTTGTGCGAACCTTCCAGGGCGAACTCGTCTAGCTTCTTCTCGAGCGCTAGCAACCAGCGTGGCATCAAGTGGATGT
TGTTGAGGATGACCCAGTGGCCATTGCGGTGGGCAACCTCAAGGCGATCCATCGCGAACACATCCTGTCCTTGGCCCATTGACACGTTGTGGTAGCTCAC
GCCTCGCTCGAAGCCGTACTTGATACTGAGTTTGTCCACGCCAGCCACCACATCGGCACCCGGAGACAGGATGAAGTACAGCGGCGTCGTTGGCGTCGAA
TCCAGGTACGAGTTGTCCATGACCTGCAACGCGTTGAGTGCCGAGTCGCAGTCGCAGTAGTTGCTTCCGTTGGGCAGAACCTGCCGCACGAACTCGTTCA
CAGCCACCGTCATCCGATCCGGACGCAAACAGCGCACAACCAGAAGCTTCAGGAAAGGCGTGCGATCGAGTCCGGCCCAATCCAGCGGCAGCTTCTCCGA
CTCGGGCGTCACGTGGTTGTACCATTCACGGAAGCGCGACGACGCCTCCTTGAGGTCCTGTGGCATCTTCTGGAACTCCTCGAGCTGCGCCAACATGTTG
ATGGCACTCCATTGAGCCGGTGGCAACCAGTCGATAGGGTTGGCTTCCTCTTCACCTCCACCTCCCGCCGCTTTCTTGGGTCCGCGCAGCAGGAACTGCA
TGTACGCTTCTTGCACTCGCACGTCGTCGCCCAGGATGCCACGACGCATGAGGTTGAACGTGAGCTGGGAGAGGAAAATGAGCTTGTGCGCTTCGAACAG
GCCGCGAGCCACCCACGTGTAGATGGTGATCCGCAACGACTCACGCAAGTTGAGCACGCGCTCGCTCTGCTTGTCGCTCTGCTGGGCTCGGTCGATCGAG
TTGTAGAAGAATGTGATGAACGAGTCCAGACTGTATCGGTACATGTGGTCGATGGCGCTGAGCGTCGTGAGCAGGAAGTAGAGCATGGCGCCCTCCGCGG
CAACAGGTCGGTACAGCTCGCGCGTGTTGTTGATGACAATCTCCGTCTCCTGGTTCTTCTTGACCGAGATGGAGATGTCCGTCGCCTTCTTCTTCGTCTC
TCCAGACTCTCGATAAGGGGACGTCGCTCAGGATATCGTCGGGGGCGTTGGCGAGACGCTCCAGCAGTTGATCCTCGAGCTCCACGAGGTCGATCTTGAA
CTTCTGGAAGGCCAGCACCAGCTCCTGCTTTCGCGCTTCGAGCTCTGGCTGCTCCTTCTTGACCACCTTCTCCAGCAGTTGGTCCTCTAGACCACTCTCC
GTGGCAATGAAGTTGATGAGCGTACACTGCGCCGCGATTTCAGGCTTGTAGTGCGGGTTCGACAGCTTCGTCTGCAAGTACATGAAGAAGTTGGGGTCGT
ACTGCACTTCCTCGCCGGCCAGTTTCAAGAAGAGGTTGGACCCCTTCTTGTACACGGCTCGCCCGAGCACCGGGTCCAGCGTGGCGTCAATCTCTTCCCC
GATGTTCTCGATGATGAGGACGTGGCCATTCACGATAGCCGTCTCGGTCTTGCGCAGCCACTGGTTCTGACTCAACTGCAGCACCACAAGGCCGCGGTCC
TTCTCCTTCTCGCGGAGCCACTTGATGCCTTGTAGCTGCGGATCGATCACCAGCGGCCAGCGTTTGCAGCTGGTGATGATGGCGCCGTTCTCAATCGAGA
TACGATCTGCAGGTAGGCCTTCGCTCATCATTTTGGCGTTCTTGCCCTCTGTCGTTAGCATCGACAGCGGATCGATGCCCTCCGTGATAGGGATCCCCTT
GGCAACCAGGTCTGGGAACCAGGTCTGCTGCCACAGCTCCTTACGCACGGCCTGGTCGAAAGCGCCGATGTACGACACGAAGGCGGCGGCCAGCAGCGAG
TTGCCAACCACCATGACACCCGAGTTCTTGAGCTGCTCGATCTCAATCCCCCAACGCTCGTTTTCACTCGCCAGGCCGTTCACGAGCTTGCCAGCTAGCA
GCAACCGGTTCTCGCACGACTCCTTCATTTCCTCGACCTTGAGCTTCTCCTCCGTCGCTTGACGCAGAGTGTTCTCGAGCGCTTCAAGCCGCTTCTGCAC
TTCCGCGACCTGGCCCATTGCGCGCGCAAGCTGCTCCTCCGCCTCCTCTTTCTTCTTCCTGGAAGCCTCGAGCGAGTCCATGAGGGGCTTGACACGCACG
TAGATGCGGTTGAACGTGTAGATGTTGACGACCCACGAGCAAATGTTGGCCGCAGCGGAGCTCTTGGACGCCATTTTCTCGGCGGTGAACTCGGGGTCTG
CGATCAGGGGCTCGATCCGAGCGATGTCTGCCTCGGGGATATCCTCGCCCTTGAAGTCCTTGAGTGCGTCCAAGAAAGCACCAGCGTTGTTCATCATCTT
CTTGGCGCGGTCCCATTTGTGGTTCTTGTACTCCTTCTCCACCAGGATGAGGCATGCCTTGGTGACATTCTCCACGCCTGCGGGCGGCTTGGGCAGACTC
TTGAGCTCCGTGATAGCAGGCTTCGACAGGCAATCCACAGCCGCCGCAGCCGCATCCATCGCCGGTTTGGCCTGCCTCAACTCCTTTTCGGCCTCGCCAG
CCAGCTCTGCTGCCGCGGCACTAGCCGCTTCGGCCTTGAACTTTTCCTTGTTGGCATTCTCCTGCTGCACCTCAGCGCCTGCCTTTTCGCGGCCCATTTG
CTCGAGCAGCTGGTCGGTGGACGCCTGCTTCTCCGCGACCTTGACCATCGTGTGCTTCAGATCCACCTGCAGCTCGGCCACATCGGCCGACGTCTTGCGC
AGCGTGGAGAGTCCATCGTCCAGGCGAGAGATTTGGCGCTGGATGTCCTCCTTCCGCTGCTTGAGCAGGATCTCGTAGAAGCTGATGAGCTCCAGGAAGC
TCTTGGGCGTCACGTAGTTGTACCTGCGCTGCGTCTCGAAGTAGTTCTTGCTCATGTCCGTCACGGAAATGTGCACGTCGGCCATGTGGTTCGCGAGGCT
GCGCTGGAGTGGGGCGTCTCCGATGTCCTCGAACTTCTCCAGGAAGCTGGAAGCAACACGCACCAGCGCATCGCGAGGCCACGGGTGGAACCAGTCGATG
ACGGTGCAGTTCACTAGACCCGGGAAACGACGAGCACGCACTCGGAACACGGCGCCCACCGGAGAGAAGCACATGATCACGCGGAAGTTGAGTCGAATAC
GCAGCAACAAGAAGTCCATGAGTGCGTCCATCGCGTCGGGGACACCATTGGCCTTGGCTTCGCTTCGCAGCGCACCCAGCAGCCCATCGAGATCCTCTTT
CGGGAAGAGATCTGGGATCCAGCCGGACGAAAGCATGTCGTTGATGTACACGAGGAACCGCTCGTTCACAATCTGCGAGTCGGTGATCAGGAACACGAGC
GGCAAGCCCTGCACACCTGCGATCTTGAACATCTCGGCCAGATTCTCCTTCAGGTCCTCAATACGGAAGTTGGACGTGACCGACAGCTGACGTACATCAA
AGCCGCAGATGTGCGACGCCAGACGCGACAGAGACTGCTTGCCGCTTCCGCCGACACCGATGAGCATCGCGTTGCCTCCTGGGTTCCCGATGATGCGGCA
GATGCGCGTCACGTGCTCCATGGCGTTGTCGAAGAGCTCCAAGTTCATCATGGAGTACTTGGAGTTGTAGTCATCGAGCTGCTCGACCAGCACCTTGTTG
AGTGCCTTCATGGAGGACACTGGCATGTACACGCTGTCCGCACCGGCCACTGCAGTTGCGAACGTCGTGAAGATGTTCACAGGCACGGGGCGTTGTCTTC
GGAGCCTGGTGGCGGTGGGGCTGGTCATTGAAAAGCGCCACCTGGTCCAAGTCCGGCAGCAGCTTCTTGGTCACCTCGCGGATCCGGTCACCGAACTTGG
CGATGTCCTCGTCGTTGATGAGGCGGTCGCAGAAGACTCGCGTGGATTCGTGCACCCACAGCCGCGTGAACGAGTACCCCGTAGGGAAGAACTCGCCCTT
GGAACGCGTGAGGCCCTGGAAAATATTCGACAACTCGCGCATGTTCCAGTTGTAGACGAACTTGGTGGCACTCGGGAGGAACCTGTTGACCATTTCCTCG
TGCAGCAGGATCGACACGTTGACAATGTGCTCGCACACGGTCATCACTTGCGAGGCAAAGCCGGCATTCTGCATGTGGCCCCTCAAGATCGAGTTGTAAA
TGGTCTTGAGGTCCTCGCGGCCAGGCATCATGCATGCGAAGAGCGCGTAGTGCCGCTGCAGGCGCCTCGTCGATGATAAAGGAGCCCGCCGTGGGGTTCA
TAGCCGACAGGTACTGGACGTCCACGATCTCCTTCCGGAAGCCCAAGTCGATACGGTCGAAGAAGGTCCTGTAGTCCATGTGCTGCCGCAGCAGAGCCAA
CGAGTTCTGAGTGCCGTACGTCTCAATGTACGGCAGGTTCAAGTCGTCGATGAAGTAGATGAGCTTCTTCGTGGCCGGCGGGCCGAACATGCGACCCGAG
CGCTTGTCAATGACCGACTCGAGCTGCTGCTGCAGCTTGGCCGAGTCCGTGTAGTAGTTCATGTTGATAGTCGAGAAGAGCATGTCGTCGTCGAGCTCAC
GCAGGAAGTTCTTGAGGATTGTGGTTTCCCCGTGCCGCTGCCCCCACAAGCATTCGCCGGCCGCTGACGCGCCACGAGCGTCTCCACCAGGAAGCGAATC
CGCACCGAGTCATTCGTGCTGATCACAATCGAGTTGAACGGCGTGTCGGCCGGACCATTGCCGATGGAGCCGGGTGCGTACTTTGGCACCTTGGTGCTCC
AGCTCTCGAACTCTCCTGACTCGAGGTTGTAGAAGTAGTCGAAGCACAGACCCTCCTTCGGGTACTTGATGTTGGTGAACGTAGAGCACCAGAGCTCGTG
GAAGTTCTTGCGGTAGTCAATACTCTTGTCAACGATGAGCGGCCCTCCGAAGGCCCACGTCGCGCAGAAGACAAAGATCGACTCGATCACCTCCGGGTTC
TTCTTCTCCGTTGGGATGTTGCCCAGAAGCCCCTCAAGCAGGTAGCAAATTGTCGACACCTGGTTGATAAGACGCACCGGAGCCACCTGCTTGTAGCCCT
TGCGCATCAGGTCGTAGATCGGGTCCACGTACTTGTCAAAGAGGCCTGGCAGATACGTCCGTTCGACTTCTTCCTCGCGCTTCGCCACCCACGACTCCAT
GAATGGACGCCAGCCGATATCAATCTCATTGATGAACAGGATACCCGCTCGAGAGACCGTAGCGGGCGTGGCATTCTTCAGCGAATTGATCTCGAAGACC
ATCCGCATGGCACTACTCAGCGGGATCCGCTCGTTCGACACGAGCGTAAGCACCTTGTTGTCGTCCATGACCGTGTTCATGGACTCTATCCACACTGCGT
CGATATCGCCGTCGAGCACCACCCACTTGTACGATTGGCTTTCGTAGAAGCCCTGCTCGGAGTAGTTCTTGGCCATACCACGCATGATAATGGACAGCAC
GCCGTCTTTCCAGTCTTTCGAGAGCGTCATGTAACCATAGAGCTCGTCGGACGTCACGGCCTTGGGGTTGAGCGTCTCGTACACGCAGATCTTCTTCTCC
TTGCCGAGGTTCCAGCACTTGGCAAGAGCCTGCCACGTCGTCGTCTTTGCGCAGCCAGCAGGGCCCAGCAGCATGACCGAGTGGCGCACATCGATAAGCT
CCTGCAGCTGGCAGATCTTGAGGATGAAGGAGTCGTCAGGCTGCAGGTTGTTGGCTTTGCACACGGCCACCGCCTTCTCTCTCAGCTCGACGTTGACCTT
GGGGGCCACCTCAACGCCAATGAATAGATCGTTGATGAGCCGGAGGAAGATCGGCGTGTCGTGGTGAGGGATCTTGGGCGTGTTGAAGTCACGCAGTGCA
CGCATGAGCACCTTATCCTCCTCGACGTCCGGCTCCGCACGCTTCAGAATGCCAGCGACACGAAGCACCGACTTGACAGCACGGAGACCCCAGTCGTAGT
GGAACTGCTTGGAGAGCAGCTCGCCACTGAGCTCGTACAGCGTCACGAACTTGATGGCCAGAGTGCGTGCCTGCTGGAATCCTTCGGACATGAGCATGTT
CTCGCAGATGGGCTTCAAGTCGGGTCGGATCATAGCGCACGATCGGAAGAGCACCTTGAGGTTTTCAGGCAGCTCCGTTCGCCCAGCGTAGCCAGGGTTC
ATCGTGATGAAGAAGCCGCACGTCGGAATGAGCGTGATCCGGTCCGAGGCTCCCATGAACTCAAACTCGCCCACGACCACGGGCGGCGTGCCGGCCGGCA
GCGTCTGGTACTTTGCCTCTCGGTTGGCGGGGATAGCATTAAACACGATAGCGTCCTGGATGCACTTGACCTGCGTAGCCACCACACTGAGCACTTCGAT
GTTGATGCGGTTGAACTCGTCGAAGCAGCCCCAAGTGCCAGTCTGGCACAGGCCGCGGAAGATGTCTGCCATGGTCTGGTAGTTCATCTGGTCCGAGCAG
TTGAACACGTAGCAGCACAAGGCCATGGCACGCGCCAAATCTTTCGTCGTCTCGGTTTTGCCAGTACCCGCAGGCCCAGCAGGAGCGCCGCCCAAGAACA
GCCTCAGCGCCATGGTCAGCGTGATGTAGCATCGATCTGTTAGAGGCGTGATCACAAGACGACCGGTGTTGCCAATCCATTCGTACGAGTACTTGGACCG
GAAGTCGGTAATTCGGATGTCCACGTCGTAGTTCTCCTGGCGCCAGATGAAGCGGAGCTGCTGCTGCCACATGAAACTGAGCGGGCCTTCCACCTTCTCG
TCGACCAGCTTTTTCACCACGTCGCGCGAGTGCACGTCAAGTGTAATGAGGGCGATGATTTTGCAGCGATCGGGGCTAGAAAGGTTGCCTAGCACGAGGT
TAATCAACTGCTCCAGGCGCTGGTTGCACACGGTCAGGTATCTCTTGACCGAGTCTTCCTGGCCGTTCTCAAACTCTTCCAGAGCCATCTCCGTCTCCTC
GGTCCAGTAAATCTGCGTCGAGTTGAGCACAACTTGGGCTGGGTAGTCAAACAGCCACTGGTGGCGAGGCTTCTCCACGTCCCAGTTGGCCGCCGTCTCG
ATCGAGTCGTGCATCTCCTTGCGGAGACAGAACCTCATGGCCTCCGTCAGCTCGTTCAGCCAGCTCTCGACTGCGCCCGCCATGACGAATATCGTGGGCA
GTCGGACGGACTCGCCGTCCTTGGCCACCATCGTGTGCGCCGTGTTCGGCGAGTCGTCCTCAAAGACGAGGTCGCACAAGGAGTCGTAGCAGTCTCCGAG
AAACGGCATGATCTTCTTCGGGTTGTTGCCGTTCGACAGGATCTCCAGCAGCGCCACGTTCGACACGAAGTAGAACCGAGGGAAGATCTTCTTCTTCTTG
TCCAGGTACTCGTTCAGCGACTTCTGGCACTTCTCCAGCATCGCAGTCATCTC