Description :
From Genome Similarity Track
Location :
contig_39:508474- 511475
Transcript NameFunction/comments
g8637.t1hypothetical protein
g8638.t1hypothetical protein

Sequence
3001 bases(100 bases per row)
AGACGTCTGTGTCGGCCGAGGCGACGGCCGCAACGGCCAATGCCGCGGCCAGGAGCGTCCTGCTCACCTTCATCCGGTACCTGTCAAGCTGTCGGTCCAA
GCTCTCTCCGACGGAGGAAAATGGGAAGTGTCCTCTGCAATAGGCAACCCCGATGGCAGACGCCGTGCAGCACTGCACTGCGTTGCCGCGCGCCAAGCAC
GCTCCATGGCGGATACAGCGGATCCATGCTGGTCCAGGTGAAGTTCGCCTGAATTGGTCGATCTCTTCAACAGAGACCAGGCGGGCCGGCTTCAGGGGTG
CAGAGGCGCTGCGAGCGCCGAAGCAGACGCGGACGGCGGCGCTGCTCAGCGCGGCGAGATCAGGTTGAGACAGGTGTGAGTGACGGCTTCACGGGGCAAC
TCTCCTGACAGGCCTGCATTGCTGCGATCGCTCGGAATCTCTCGCAATGCAATGGCGGCGCTGTCGTAGCGAGCGAAATGCATGAGACGACGGGTAATAC
ACCGCAACTCGCTCGCTCTCGTTAACTATCTCTCTCAACTGTACACAGCATTCCTCGTGGCATCAGTGCTCCCTATGGCATCCCCTGCATCGATGAGCTT
GTCGCCGCTGTCGGGTGCGCTTCGAACAGAAAGAAGCGGGCGGCGGCATTGCAATTGTGCCGGAAATGGCGCCTGCGATTGTCTGCTACACCGGCAATCT
CCGCATGTCACTCACAGTGGATCAACGCGAGGATACCGAGTGGGACTTTGCTCAGTCAGCGATGAGTCATGCGGCAAGACAAAACAAACAAGTAATCCCC
CGCCCCCACCACCATGAGTGTAAGTCGAGAATGGAAAACTGCACGGATTCAATTTCCGGAGTTACTAAATGAAAGTCCAACAATCATAGCTCCCAAGCCT
GCGCTCCGGCCCGAGCGCTAGCCAATGCTATGGATACATGTACCTTACTGGGACTGCTGCTGATCCTGGTCAGGCAGCGACGTCACGGGGCACGGAGTGG
TGGTGGCGGGGGTCGTCGTTGTGTCAGGCAGCGAGGTCACAGGGCAAGGCGTAGTGGCTGCCGGGGTACTCGTCGGGGCATCCGTGCTGTCCGGAAGAGA
AGTCACCGGGCATGGCGTCGTAGACGAAGGCGTCGAGGTAGGCGCGTCGGTCGTGTCGGGAAGCGAAGTCACCGGGCATGGCGTCGTAGACGAAGGCGTC
GAAGTAGGCGCGTCGGTCGTGTCGGGAAGCGAAGTCACCGGGCATGGCGTCGTAGACGAAGGCGTCGAGGTAGGTGCGTCGGTCGTGTCGGGAAGCGAAG
TCACCGGGATGCGTCGTAGACGAAGGCGTCGAGGTAGGTGCGTCGGTCGTGTCGGGAAGCGAAGTCACCGGGCATGGCGTCGTAGACGAAGGCGTCGAGG
TAGGTGCGTCGGTCGTGTCGGGAAGCGAAGTCACCGGGCAAGGAGTCGTCGCTGACCTCTCCGAAGCGCCTGTATCCGGCAACGACGTCACCGGGCATGG
CGTCGTCACAGCAGGTGTCGAGGTAGGCGCGTCGGTCGTGTCGGGAAGCGAAGTCACCGGGCATGGCGTCGTCGCAACTGGCGTCGATGTCGTGGGAGCG
TCCGTACTGTCAGGGAGCGAAGTGACTGGGCACGGTGTGGCAGCCGTAGTCGACGTAGGGGCGTCAGTGGTGTCCGGCAAAGAAGTCACAGGGCACGGGG
TCGTTGACGTGGTTGAAGCAGGAGCATCGGTCGTTTCCGGGAGTGAGGTAACAGGGCACGGCGTCGTGGTCGCAGTGTCCGGTAACGAGGTCACCGGGCA
TGGCGTAGCCGTCGATTCCGTTGATCCGGCCGTAGATGCCACCGTGTCGGGAAGCGAAGTCACCGGGCAAGGAGTCGTCGCTGACCTCTCCGAAGCACCT
GTATCCGGCAACGACGTCACTGGGCATGGCGTCGTGGTTTCCGTGTCTGGAAGCGACGTGACCGGGCAAGGCGTTGTCGTCTCGGTGTCCGGCAGGGAAG
TCACTGGACACGGAGTCGTCGTCTCGGTGTCCGGGAGCGACGTAACAGGGCACGGCGTCGTGGCTTCAGCGTCAGGGAGTGAGGTGACCGGGCAAGGAGT
ACTGGTCTCTGTGTCCGGAAGAGAAGTCACTGGGCAAGGAGTACTGGTCTCTGTGTCCGGGAGCGACGTAACAGGGCATGGAGTCGTCGTCTCGGTGTCC
GGCAGGGAAGTCACCGGACACGGAGTCGTCGTCTCCGTGTCAGGGAGCGACGTAATAGGACACGGGGTCGTCGTCTCGTTCGTGTCGGGCAGGCTGGTGA
CCGGGCATGGGGTGGTCGCGTTGGTGTCCGGCAGACTCGTCACGGGACACGGTGTCGAAGAGCTACCGGTGCAGCCCACGGACGGGAACACGCAGCCCCA
CGTGTCGCCGTTCACGATGGTGCACTCGGCGTCCTCTTGCGCTGTGCACTGCGATCCGTCATACGACGGCAGGTATGAGTGGCAGTCGGCCGTGGCCGCG
TCGCCCTTGAGCGGGCAGGAGGTGCCGGCAGGGGCGCTGCCTGCTCCTGAGCAAATGGCGCCGCGCGAGTCCGCGATCGTGTAGGTAGCGTCTCTGCAGA
CGGAGACGTCCGTGTCGGCCGAGGCCGCCACGACGGCCAGCGCTGCGGCCAGGAGCGTCCTGGTGGTGGCAACGACCTTCATGGGGTGTAGAAGCTGTGG
GTTTGGTACAGGAGTCTGCGATTTCCTGTGAGCGCAACGCCGGAGAATTGGGAAGTGCCCTGCAGGATAGAGGCAAAGGCAGGCGATGGTCAAAGCACGG
GATTCACTCACACAGTTGCAGTTGCTACGAAAAGGACATGTGGCAGGATGACTCGCTCTCAGTATGGGAAGTGCGTGCGGAGACCGTCTTTATCGTCCGC
TTGGGCAGATTCCTGTGACAAAAGGCGAGTGAATCCGTGCGTAACTCGAGCGCTCAGCAGTTTCTGCGCGGCGCTGATCACCTCGGAGGTGACCTCGGCC
G