Description :
From Genome Similarity Track
Location :
contig_39:508403- 511404
Transcript NameFunction/comments
g8260.t1hypothetical protein
g8261.t1hypothetical protein

Sequence
3001 bases(100 bases per row)
CCGAGGCGACGGCCGCAACGGCCAATGCCGCGGCCAGGAGCGTCCTGCTCACCTTCATCCGGTACCTGTCAAGCTGTCGGTCCAAGCTCTCTCCGACGGA
GGAAAATGGGAAGTGTCCTCTGCAATAGGCAACCCCGATGGCAGACGCCGTGCAGCACTGCACTGCGTTGCCGCGCCCCAAGCACGCTCCATGGCGGATA
CAGCGGATCCATGCTGGTCCAGGTGAAGTTCGCCTGAATTGGTCGATCTCTTCAACAGAGACCAGGCGGGCCGGCTTCAGGGGTGCAGAGGCGCTGCGAG
CGCCGAAGCAGACGCGGACGGCGGCGCTGCTCAGCGCGGCGAGATCAGGTTGAGACAGGTGTGAGTGACGGCTTCACGGGGCAACTCTCCTGACAGGCCT
GCATTGCTGCGATCGCTCGGAATCTCTCGCAATGCAATGGCGGCGCTGTCGTAGCGAGCGAAATGCATGAGACGACGGGTAATACACCGCAACTCGCTCG
CTCTCGTTAACTATCTCTCTCAACTGTACACAGCATTCCTCGTGGCATCAGTGCTCCCTATGGCATCCCCTGCATCGATGAGCTTGTCGCCGCTGTCGGG
TGCGCTTCGAACAGAAAGAAGCGGGCGGCGGCATTGCAATTGTGCCGGAAATGGCGCCTGCGATTGTCTGCTACACCGGCAATCTCCGCATGTCACTCAC
AGTGGATCAACGCGAGGATACCGAGTGGGACTTTGCTCAGTCAGCGATGAGTCATGCGGCAAGACAAAACAAACAAGTAATCCCCCGCCCCCACCACCAT
GAGTGTAAGTCGAGAATGGAAAACTGCACGGATTCAATTTCCGGAGTTACTAAATGAAAGTCCAACAATCATAGCTCCCAAGCCAGCGCTCCGGCCCGAG
CGCTAGCCAATGCTATGGATACATGTACCTCACTGGGACTGCTGCTGATCCTGGTCAGGCAGCGACGTCACGGGGCACGGAGTGGTGGTGGCGGGGGTCG
TCGTTGTGTCAGGCAGCGAGGTCACAGGGCAAGGCGTAGTGGCTGCCGGGGTACTCGTCGGGGCATCCGTGCTGTCCGGAAGAGAGGTCACCGGGCATGG
CGTCGTCACAGCAGGCGTCGAAGTAGGCGCGTCGGTCGTGTCGGGAAGCGAAGTCACCGGGCATGGCGTCGTAGACGAAGGCGTCGAGGTAGGCGCGTCG
GTCGTGTCGGGAAGCGAAGTCACCGGGCATGGCGTCGTAGACGAAGGCGTCGAGGTAGGCGCGTCGGTCGTGTCGGGAAGCGAAGTCACCGGGATGCGTC
GTAGACGAAGGCGTCGAGGTAGGTGCGTCGGTCGTGTCGGGAAGCGAAGTCACCGGGCATGGCGTCGTAGACGAAGGCGTCGAGGTAGGTGCGTCGGTCG
TGTCGGGAAGCGAAGTCACCGGGCAAGGAGTCGTCGCTGACCTCTCCGAAGCGCCTGTATCCGGCAACGACGTCACCGGGCATGGCGTCGTCACAGCAGG
TGTCGAGGTAGGCGCGTCGGTCGTGTCGGGAAGCGAAGTCACCGGGCATGGCGTCGTCGCAACTGGCGTCGATGTCGTGGGAGCGTCCGTACTGTCAGGG
AGCGAAGTGACTGGGCACGGTGTGGCAGCCGTAGTCGACGTAGGGGCGTCAGTGGTGTCCGGCAAAGAAGTCACAGGGCACGGGGTCGTTGACGTGGTTG
AAGCAGGAGCATCGGTCGTTTCCGGGAGTGAGGTAACAGGGCACGGCGTCGTGGTCGCAGTGTCCGGTAACGAGGTCACCGGGCATGGCGTAGCCGTCGA
TTCCGTTGATCCGGCCGTAGATGCCACCGTGTCGGGGAGCGAAGTTACCGGGCAAGGAGTCGTCGCTGACCTCTCCGAAGCACCTGTATCCGGCAACGAC
GTCACTGGGCATGGCGTCGTGGTTTCCGTGTCTGGAAGCGACGTGACCGGGCAAGGCGTTGTCGTCTCGGTGTCCGGCAGGGATGTCACTGGACACGGAG
TCGTCGTCTCGGTGTCCGGGAGCGACGTAACAGGGCACGGCGTCGTGGCTTCAGCGTCAGGGAGTGAGGTGACCGGGCAAGGAGTACTGGTCTCTGTGTC
CGGAAGAGAAGTCACTGGGCAAGGAGTACTGGTCTCTGTGTCCGGGAGCGACGTAACAGGGCATGGAGTCGTCGTCTCGGTGTCCGGCAGGGAAGTCACC
GGACACGGAGTCGTCGTCTCCGTGTCAGGGAGCGACGTAACAGGACACGGGGTCGTCGTCTCGTTCGTGTCGGGCAGGCTGGTGACCGGGCATGGGGTGG
TCGCGTTGGTGTCCGGCAGACTCGTCACGGGACACGGTGTCGAAGAGCTACCGGTGCAGCCCACGGACGGGAACACGCAGCCCCACGTGTCGCCGTTCAC
GATGGTGCACTCGGCGTCCTCTTGCGCTGTGCACTGCGATCCGTCATACGACGGCAGGTATGAGTGGCAGTCGGCCGTGGCCGCGTCGCCCTTGAGCGGG
CAGGAGGTGCCGGCAGGGGCGCTGCCTGCTCCTGAGCAAATGGCGCCGCGCGAGTCCGCGATCGTGTAGGTAGCGTCTCTGCAGACGGAGACGTCCGTGT
CGGCCGAGGCCGCCACGACGGCCAGCGCTGCGGCCAGGAGCGTCCTGGTGGTGGCAACGACCTTCATGGGGTGTAGAAGCTGTGGGTTTGGTACAGGAGT
CTGCGATTTCCTGTGAGCGCAACGCCGGAGAATTGGGAAGTGCCCTGCAGGATAGAGGCAAAGGCAGGCGATGGTCAAAGCACGGGATTCACTCACACAG
TTGCAGTTGCTACGAAAAGGACATGTGGCAGGATGACTCGCTCTCAGTATGGGAAGTGCGTGCGGAGACCGTCTTTATCGTCCGCTTGGGCAGATTCCTG
TGACAAAAGGCGAGTGAATCCGTGCGTAACTCGAGCGCTCAGCAGTTTCTGCGCGGCGCTGATCACCTCGGAGGTGACCTCGGCCGGATGAACGCGTCGG
T