Description :
From Genome Similarity Track
Location :
contig_22:508392- 517483
Transcript NameFunction/comments
g5677.t1XP_008902204.1 hypothetical protein PPTG_09098 [Phytophthora parasitica INRA-310

Sequence
9091 bases(100 bases per row)
AGGGGACATTGGAGCTCTGGAGGCAGCACACGCTCAAAGCGAGACAAGGGTAGAGATGATAGAATGCATTTGCTGCTTTGCTTGAGCAAGCACTTTACGG
TTGTGTTGTGTTGCTTGATTGCTAACGACTGACTGACTAGACGATGTCCATGATGAGCGCGACGCCCGCGAGAACCCAGCGAGCAGGTGGCGACTTGGAC
TTGAGCTGCGCCGAGAAGACGTAGGTGGGTCCACGGAACTCCGTCTTGTAGCACGGACAGACGTACGACCCCTTGATGTCGAGTTTGTCGGAAGCCACCG
CCTTGCAGTTGATGACGGGCATGGGGGAGAACATTTCCTTGGGGTGCGAGCGGTCCACCGTGTTGTTCTGCACGTCCCAGCGCGCACCCATGAGGTACAG
GCCGTGATGTAGGCTCCGTCGCGCGATGGAGCGTCCACTTCGCCGTTGCGGCGCTTGAGCACGTCCTGTCTGGATCACGAGCTTGTCGAGCTCCCACTGG
TTCTTCTGGGCCGTGACCTGCATGATTGCGGTCAGGAACGACTGCGGGTTGATCATGCCCGAGAGCCACGTGACGCGAGGGATGTCTGCCGGGTTTTGCG
TCCATTCCTCCAGTTGCAGCAGTCGTGCTTCGAGGTTCGTGAGCCATGAGCCAAGTGGGCGCATGGACGGGAAAGCGAGCTTCTCCCACGACTTCGGTAC
ACGATCCAGGAACAGCGACTCCTGCACGGCCTCCATGGCGTCCGACATGGTGAGTTCACCGGCAAACCCTAGCGACAATTCGTTCAGCGATCGGACAACC
TCGGCTAGCAACCCGTTCATGGCCTCGCACTCCTGGATAAACACGTTCTGGTACGGCCCCATCTCTTCGAGGTTGCGCGAGATCTCGTCGCACTCGAACT
TCTTCTCGCCGATGCGCGAGAGCACCATCTCTAGACCTTGCTTTGCCAGCTCGAGCGGACTCATGGTAGCGTCGCCTGCTGCGGCATCTCGTGGCTGCAG
CTCCATCAACGTCCGGAACAGGTTCTCGGACTGCGTCGTACGGAAATCGATTTCTGCATTCGGGTGCAGTCCGAAGGCCAGCGGCGAGTCCGTCTTGAAG
CTCCGTCTCGATGTGCTCCAGGTACTTGTCATAGGACGAAGGTGCAAGGCACATGAAGGACGGACCCTTTTCATCGCCGACAAAAGGGAACATCTCCATC
TCGTCCAGCAGCTCGTCGCGCATGTAGAAGTCCAGGTACGTGTTGGCTAGCAGCCGATCGAAGTCGTTCACAATATGCCCGCCGTACATGATCTCACCGA
AGATGTAGCGAAGATCGGCCCACGGGATCTTGCCGCCTGCTGAGCTTTCGAGGTAGTTCTGCAGACAGATAGCGGAGTCGCGCAGGTCGCCGAGCGAGAA
GGGGTACATCATGTTGAAGCCCAGAGGGCCGTACATCTTGCGCTCCATGAGCACGGCGTGGAAGTGGCAGAGGCCGAACAAAATGGATTTGACCTTGCCT
TCAGCCTCCTCGATGTACTCCTTGGCAAAGCTCACGAAGGCTCGCTTCAAGTTGGCCTTGAGACCGGACGGCGGCTCGTTTGTCAGCTTGATGCAGCGGT
TGAGCACGCCGATGGGGATGGAGTTGGACGGGTCCGACGTCAGGAACAAGCGGAAGTTCTTGTGCGAACCTTCCAGGGCGAACTCGTCTAGCTTCTTCTC
GAGCGCTAGCAACCAGCGTGGCATCAAGTGGATGTTGTTGAGGATGACCCAGTGGCCATTGCGGTGGGCAACCTCAAGGCGATCCATCGCGAACACATCC
TGTCCTTGGCCCATTGACACGTTGTGGTAGCTCACGCCTCGCTCGAAGCCGTACTTGATACTGAGTTTGTCCACGCCAGCCACCACATCGGCACCCGGAG
ACAGGATGAAGTACAGCGGCGTCGTTGGCGTCGAATCCAGGTACGAGTTGTCCATGACCTGCAACGCGTTGAGTGCCGAGTCGCAGTCGCAGTAGTTGCT
TCCGTTGGGCAGAACCTGCCGCACGAACTCGTTCACAGCCACCGTCATCCGATCCGGACGCAAACAGCGCACAACCAGAAGCTTCAGGAAAGGCGTGCGA
TCGAGTCCGGCCCAATCCAGCGGCAGCTTCTCCGACTCGGGCGTCACGTGGTTGTACCATTCACGGAAGCGCGACGACGCCTCCTTGAGGTCCTGTGGCA
TCTTCTGGAACTCCTCGAGCTGCGCCAACATGTTGATGGCACTCCATTGAGCCGGTGGCAACCAGTCGATAGGGTTGGCTTCCTCTTCACCTCCACCTCC
CGCCGCTTTCTTGGGTCCGCGCAGCAGGAACTGCATGTACGCTTCTTGCACTCGCACGTCGTCGCCCAGGATGCCACGACGCATGAGGTTGAACGTGAGC
TGGGAGAGGAAAATGAGCTTGTGCGCTTCGAACAGGCCGCGAGCCACCCACGTGTAGATGGTGATCCGCAACGACTCACGCAAGTTGAGCACGCGCTCGC
TCTGCTTGTCGCTCTGCTGGGCTCGGTCGATCGAGTTGTAGAAGAATGTGATGAACGAGTCCAGACTGTATCGGTACATGTGGTCGATGGCGCTGAGCGT
CGTGAGCAGGAAGTAGAGCATGGCGCCCTCCGCGGCAACAGGTCGGTACAGCTCGCGCGTGTTGTTGATGACAATCTCCGTCTCCTGGTTCTTCTTGACC
GAGATGGAGATGTCCGTCGCCTTCTTCTTCGTCTCCTCCAGACTCTCGATAAGGGGGACGTCGCTCAGGATATCGTCGGGGGCGTTGGCGAGACGCTCCA
GCAGTTGATCCTCGAGCTCCACGAGGTCGATCTTGAACTTCTGGAAGGCCAGCACCAGCTCCTGCTTTCGCGCTTCGAGCTCTGGCTGCTCCTTCTTGAC
CACCTTCTCCAGCAGTTGGTCCTCTAGACCACTCTCCGTGGCAATGAAGTTGATGAGCGTACACTGCGCCGCGATTTCAGGCTTGTAGTGCGGGTTCGAC
AGCTTCGTCTGCAAGTACATGAAGAAGTTGGGGTCGTACTGCACTTCCTCGCCGGCCAGTTTCAAGAAGAGGTTGGACCCCTTCTTGTACACGGCTCGCC
CGAGCACCGGGTCCAGCGTGGCGTCAATCTCTTCCCCGATGTTCTCGATGATGAGGACGTGGCCATTCACGATAGCCGTCTCGGTCTTGCGCAGCCACTG
GTTCTGACTCAACTGCAGCACCACAAGGCCGCGGTCCTTCTCCTTCTCGCGGAGCCACTTGATGCCTTGTAGCTGCGGATCGATCACCAGCGGCCAGCGT
TTGCAGCTGGTGATGATGGCGCCGTTCTCAATCGAGATACGATCTGCAGGTAGGCCTTCGCTCATCATTTTGGCGTTCTTGCCCTCTGTCGTTAGCATCG
ACAGCGGATCGATGCCCTCCGTGATAGGGATCCCCTTGGCAACCAGGTCTGGGAACCAGGTCTGCTGCCACAGCTCCTTACGCACGGCCTGGTCGAAAGC
GCCGATGTACGACACGAAGGCGGCGGCCAGCAGCGAGTTGCCAACCACCATGACACCCGAGTTCTTGAGCTGCTCGATCTCAATCCCCCAACGCTCGTTT
TCACTCGCCAGGCCGTTCACGAGCTTGCCAGCTAGCAGCAACCGGTTCTCGCACGACTCCTTCATTTCCTCGACCTTGAGCTTCTCCTCCGTCGCTTGAC
GCAGAGTGTTCTCGAGCGCTTCAAGCCGCTTCTGCACTTCCGCGACCTGGCCCATTGCGCGCGCAAGCTGCTCCTCCGCCTCCTCTTTCTTCTTCCTGGA
AGCCTCGAGCGAGTCCATGAGGGGCTTGACACGCACGTAGATGCGGTTGAACGTGTAGATGTTGACGACCCACGAGCAAATGTTGGCCGCAGCGGAGCTC
TTGGACGCCATTTTCTCGGCGGTGAACTCGGGGTCTGCGATCAGGGGCTCGATCCGAGCGATGTCTGCCTCGGGGATATCCTCGCCCTTGAAGTCCTTGA
GTGCGTCCAAGAAAGCACCAGCGTTGTTCATCATCTTCTTGGCGCGGTCCCATTTGTGGTTCTTGTACTCCTTCTCCACCAGGATGAGGCATGCCTTGGT
GACATTCTCCACGCCTGCGGGCGGCTTGGGCAGACTCTTGAGCTCCGTGATAGCAGGCTTCGACAGGCAATCCACAGCCGCCGCAGCCGCATCCATCGCC
GGTTTGGCCTGCCTCAACTCCTTTTCGGCCTCGCCAGCCAGCTCTGCTGCCGCGGCACTAGCCGCTTCGGCCTTGAACTTTTCCTTGTTGGCATTCTCCT
GCTGCACCTCAGCGCCTGCCTTTTCGCGGCCCATTTGCTCGAGCAGCTGGTCGGTGGACGCCTGCTTCTCCGCGACCTTGACCATCGTGTGCTTCAGATC
CACCTGCAGCTCGGCCACATCGGCCGACGTCTTGCGCAGCGTGGAGAGTCCATCGTCCAGGCGAGAGATTTGGCGCTGGATGTCCTCCTTCCGCTGCTTG
AGCAGGATCTCGTAGAAGCTGATGAGCTCCAGGAAGCTCTTGGGCGTCACGTAGTTGTACCTGCGCTGCGTCTCGAAGTAGTTCTTGCTCATGTCCGTCA
CGGAAATGTGCACGTCGGCCATGTGGTTCGCGAGGCTGCGCTGGAGTGGGGCGTCTCCGATGTCCTCGAACTTCTCCAGGAAGCTGGAAGCAACACGCAC
CAGCGCATCGCGAGGCCACGGGTGGAACCAGTCGATGACGGTGCAGTTCACTAGACCCGGGAAACGACGAGCACGCACTCGGAACACGGCGCCCACCGGA
GAGAAGCACATGATCACGCGGAAGTTGAGTCGAATACGCAGCAACAAGAAGTCCATGAGTGCGTCCATCGCGTCGGGGACACCATTGGCCTTGGCTTCGC
TTCGCAGCGCACCCAGCAGCCCATCGAGATCCTCTTTCGGGAAGAGATCTGGGATCCAGCCGGACGAAAGCATGTCGTTGATGTACACGAGGAACCGCTC
GTTCACAATCTGCGAGTCGGTGATCAGGAACACGAGCGGCAAGCCCTGCACACCTGCGATCTTGAACATCTCGGCCAGATTCTCCTTCAGGTCCTCAATA
CGGAAGTTGGACGTGACCGACAGCTGACGTACATCAAAGCCGCAGATGTGCGACGCCAGACGCGACAGAGACTGCTTGCCGCTTCCGCCGACACCGATGA
GCATCGCGTTGCCTCCTGGGTTCCCGATGATGCGGCAGATGCGCGTCACGTGCTCCATGGCGTTGTCGAAGAGCTCCAAGTTCATCATGGAGTACTTGGA
GTTGTAGTCATCGAGCTGCTCGACCAGCACCTTGTTGAGTGCCTTCATGGAGGACACTGGCATGTACACGCTGTCCGCACCGGCCACTGCAGTTGCGAAC
GTCGTGAAGATGTTCACAGGCACGGGGGCGTTGTCTTCGGAGCCTGGTGGCGGTGGGGGCTGGTCATTGAAAAGCGCCACCTGGTCCAAGTCCGGCAGCA
GCTTCTTGGTCACCTCGCGGATCCGGTCACCGAACTTGGCGATGTCCTCGTCGTTGATGAGGCGGTCGCAGAAGACTCGCGTGGATTCGTGCACCCACAG
CCGCGTGAACGAGTACCCCGTAGGGAAGAACTCGCCCTTGGAACGCGTGAGGCCCTGGAAAATATTCGACAACTCGCGCATGTTCCAGTTGTAGACGAAC
TTGGTGGCACTCGGGAGGAACCTGTTGACCATTTCCTCGTGCAGCAGGATCGACACGTTGACAATGTGCTCGCACACGGTCATCACTTGCGAGGCAAAGC
CGGCATTCTGCATGTGGCCCCTCAAGATCGAGTTGTAAATGGTCTTGAGGTCCTCGCGGCCAGGCATCATGCATGCGAAGAGCGCGTAGTGCCGCTGCAG
GCGCTCGTCGATGATAAAGGAGCCCGCCGTGGGGTTCATAGCCGACAGGTACTGGACGTCCACGATCTCCTTCCGGAAGCCCAAGTCGATACGGTCGAAG
AAGGTCCTGTAGTCCATGTGCTGCCGCAGCAGAGCCAACGAGTTCTGAGTGCCGTACGTCTCAATGTACGGCAGGTTCAAGTCGTCGATGAAGTAGATGA
GCTTCTTCGTGGCCGGCGGGCCGAACATGCGACCCGAGCGCTTGTCAATGACCGACTCGAGCTGCTGCTGCAGCTTGGCCGAGTCCGTGTAGTAGTTCAT
GTTGATAGTCGAGAAGAGCATGTCGTCGTCGAGCTCACGCAGGAAGTTCTTGAGGATTGTGGTTTCCCCGTGCCGCTGCCCCCACAAGCATTCGCCGGCC
GCTGACGCGCCACGAGCGTCTCCACCAGGAAGCGAATCCGCACCGAGTCATTCGTGCTGATCACAATCGAGTTGAACGGCGTGTCGGCCGGACCATTGCC
GATGGAGCCGGGTGCGTACTTTGGCACCTTGGTGCTCCAGCTCTCGAACTCTCCTGACTCGAGGTTGTAGAAGTAGTCGAAGCACAGACCCTCCTTCGGG
TACTTGATGTTGGTGAACGTAGAGCACCAGAGCTCGTGGAAGTTCTTGCGGTAGTCAATACTCTTGTCAACGATGAGCGGCCCTCCGAAGGCCCACGTCG
CGCAGAAGACAAAGATCGACTCGATCACCTCCGGGTTCTTCTTCTCCGTTGGGATGTTGCCCAGAAGCCCCTCAAGCAGGTAGCAAATTGTCGACACCTG
GTTGATAAGACGCACCGGAGCCACCTGCTTGTAGCCCTTGCGCATCAGGTCGTAGATCGGGTCCACGTACTTGTCAAAGAGGCCTGGCAGATACGTCCGT
TCGACTTCTTCCTCGCGCTTCGCCACCCACGACTCCATGAATGGACGCCAGCCGATATCAATCTCATTGATGAACAGGATACCCGCTCGAGAGACCGTAG
CGGGCGTGGCATTCTTCAGCGAATTGATCTCGAAGACCATCCGCATGGCACTACTCAGCGGGATCCGCTCGTTCGACACGAGCGTAAGCACCTTGTTGTC
GTCCATGACCGTGTTCATGGACTCTATCCACACTGCGTCGATATCGCCGTCGAGCACCACCCACTTGTACGATTGGCTTTCGTAGAAGCCCTGCTCGGAG
TAGTTCTTGGCCATACCACGCATGATAATGGACAGCACGCCGTCTTTCCAGTCTTTCGAGAGCGTCATGTAACCATAGAGCTCGTCGGACGTCACGGCCT
TGGGGTTGAGCGTCTCGTACACGCAGATCTTCTTCTCCTTGCCGAGGTTCCAGCACTTGGCAAGAGCCTGCCACGTCGTCGTCTTTGCGCAGCCAGCAGG
GCCCAGCAGCATGACCGAGTGGCGCACATCGATAAGCTCCTGCAGCTGGCAGATCTTGAGGATGAAGGAGTCGTCAGGCTGCAGGTTGTTGGCTTTGCAC
ACGGCCACCGCCTTCTCTCTCAGCTCGACGTTGACCTTGGGGGCCACCTCAACGCCAATGAATAGATCGTTGATGAGCCGGAGGAAGATCGGCGTGTCGT
GGTGAGGGATCTTGGGCGTGTTGAAGTCACGCAGTGCACGCATGAGCACCTTATCCTCCTCGACGTCCGGCTCCGCACGCTTCAGAATGCCAGCGACACG
AAGCACCGACTTGACAGCACGGAGACCCCAGTCGTAGTGGAACTGCTTGGAGAGCAGCTCGCCACTGAGCTCGTACAGCGTCACGAACTTGATGGCCAGA
GTGCGTGCCTGCTGGAATCCTTCGGACATGAGCATGTTCTCGCAGATGGGCTTCAAGTCGGGTCGGATCATAGCGCACGATCGGAAGAGCACCTTGAGGT
TTTCAGGCAGCTCCGTTCGCCCAGCGTAGCCAGGGTTCATCGTGATGAAGAAGCCGCACGTCGGAATGAGCGTGATCCGGTCCGAGGCTCCCATGAACTC
AAACTCGCCCACGACCACGGGCGGCGTGCCGGCCGGCAGCGTCTGGTACTTTGCCTCTCGGTTGGCGGGGATAGCATTAAACACGATAGCGTCCTGGATG
CACTTGACCTGCGTAGCCACCACACTGAGCACTTCGATGTTGATGCGGTTGAACTCGTCGAAGCAGCCCCAAGTGCCAGTCTGGCACAGGCCGCGGAAGA
TGTCTGCCATGGTCTGGTAGTTCATCTGGTCCGAGCAGTTGAACACGTAGCAGCACAAGGCCATGGCACGCGCCAAATCTTTCGTCGTCTCGGTTTTGCC
AGTACCCGCAGGCCCAGCAGGAGCGCCGCCCAAGAACAGCCTCAGCGCCATGGTCAGCGTGATGTAGCATCGATCTGTTAGAGGCGTGATCACAAGACGA
CCGGTGTTGCCAATCCATTCGTACGAGTACTTGGACCGGAAGTCGGTAATTCGGATGTCCACGTCGTAGTTCTCCTGGCGCCAGATGAAGCGGAGCTGCT
GCTGCCACATGAAACTGAGCGGGCCTTCCACCTTCTCGTCGACCAGCTTTTTCACCACGTCGCGCGAGTGCACGTCAAGTGTAATGAGGGCGATGATTTT
GCAGCGATCGGGGCTAGAAAGGTTGCCTAGCACGAGGTTAATCAACTGCTCCAGGCGCTGGTTGCACACGGTCAGGTATCTCTTGACCGAGTCTTCCTGG
CCGTTCTCAAACTCTTCCAGAGCCATCTCCGTCTCCTCGGTCCAGTAAATCTGCGTCGAGTTGAGCACAACTTGGGCTGGGTAGTCAAACAGCCACTGGT
GGCGAGGCTTCTCCACGTCCCAGTTGGCCGCCGTCTCGATCGAGTCGTGCATCTCCTTGCGGAGACAGAACCTCATGGCCTCCGTCAGCTCGTTCAGCCA
GCTCTCGACTGCGCCCGCCATGACGAATATCGTGGGCAGTCGGACGGACTCGCCGTCCTTGGCCACCATCGTGTGCGCCGTGTTCGGCGAGTCGTCCTCA
AAGACGAGGTCGCACAAGGAGTCGTAGCAGTCTCCGAGAAACGGCATGATCTTCTTCGGGTTGTTGCCGTTCGACAGGATCTCCAGCAGCGCCACGTTCG
ACACGAAGTAGAACCGAGGGAAGATCTTCTTCTTCTTGTCCAGGTACTCGTTCAGCGACTTCTGGCACTTCTCCAGCATCGCAGTCATCTC