Description :
From Genome Similarity Track
Location :
scaffold_28:50831- 78778
Transcript NameFunction/comments
Pl_111803hypothetical protein PHYSODRAFT_533271
Pl_111804hypothetical protein PHYSODRAFT_307605
Pl_111805hypothetical protein PHYSODRAFT_532679
Pl_111806hypothetical protein PHYSODRAFT_320033
Pl_111807hypothetical protein PHYSODRAFT_566404
Pl_111808notchless family protein
Pl_111809hypothetical protein PITG_04723
Pl_111810hypothetical protein PHYSODRAFT_307610
Pl_111811conserved hypothetical protein
Pl_111812mitochondrial-processing peptidase subunit alpha, putative

Sequence
27947 bases(100 bases per row)
CTGCTCAATCAAATCCCTCCATTACACATTCTCGATATGCTTGAAGCTAGCAGCGCTGTTCTCAAGATCTGCGCTCAACCCCGCAGCGTCTGATATGCCA
TTGGCGCTGGATCCCGATCGAAACCACTCTAGAGCATACTCTTTGTTCTTTTGAAAGCAAAGGAAAGCTTCCACCAAGGCCCCACTATCAGCTAGGGTGG
CCTCACGCGCGACACCTTCTGTGCGCAGAAGTACTAAGTAGACGTTGTTTCGGACAGCCCCACTATCAGCTAGGGTGGCCTCGCGCGCGACACCTTCTGT
GCGCAGTAGTACTAAGTAGACGTTGTTTCGGACAGTTTCACCACTCGATGACGCCGCCGGCAGTGACAATACCATTTCGGCATAGGGTGCAATCAGCGGA
AAGCGTAATTGGTTTGTTTTCCACCATACCAATGGATCCACGTTGCGCTCGGAAACAGGAAGACTTAGGAATGCACTCAGCTCCTTCTCCCATGTCGCGA
CCATCTCGTTATCGCCCTGAAGAGATGACTTGGACGATTCAGACGGCAAATGTGAAAGCAAGTCATCATCTTCATCGTCAGCGAGGGCTACGTTCCCTGC
TGGACTAGCAGGTTCCTTCACCAGCTCTGTATAACTTGACGTCGACATTCTAGCCACGGCATCTGCGTTAGACTCTGACAAACCTGTAGAACCGGCCGCA
GTCGAGTCACCTTCAAACGTGAACATCCGACGTAAGAAATCCTTGCCAACATCGCACTCGATCTTGGGAGACAGATAACAGTATTCGCGGTTCTTGTAGC
GCGGATCGAACAGCGTTGCCGCGTAACAGATAGGGTGTAGCGTTCCAAACTGATTGCGCAATTTCCTCGCTAGGGTCTCAAAGAAGCGTTTCCATGAGGT
AGGCTCCAGGTGGGCCGGCACACCTTCAGAAACTGAAAGTGCTTGTTTTTCTGCATACGACACCAATGCTGCTGCAATGGTTGAAATACTCGAAATGCCG
TTCTTGTTCACTTCCTTGTCGCTACCAGTTTTCTTGTTCTTCTCTCCTTCTAGAGCCTCAGAGTACCGAGCAAAAGGCCGCAACTTCTTCACAAGCAGAC
CAATGAACTCCACAATTGACGCAGGCAGGTAGTCCACCAAGTTCGCATTTGCGATCTGCTCCAATGTGGGCAAGTGTTCAAGCAAGTCACGTAGGAACTC
GTAATACGAAGTTGATTCGTACCCTTTTGGGGACAACTCAACGTTGAAGAGTGGACACTTACGACTCAGCGAAAGGATCGCTCCCTCATTTTCTGCCAGT
CGATCCATAAACTCCTCTATCTGACTTACCACATCAGGAAACGCCTTAGAAAAAATGTCCTGTGTCAAACAGACTCGCAAGTGCTGCACCGCAGACGTAA
GAAGGAGCGTGTTCTGTGCTGCATCATGCGAGACAATCCGTCCGTCGAAGTTAATCGGCACAAAAAGCGACGGAAGATCAGTTGCCGTGAGTTCAACCTT
CGCCGGTAGTTCATCCTTGAAACAGGCAATCACCTTGTCCTTAATGCCAAGTCGTTCGAGGTACGAGTCAAGAATATTCTTGATCGTTTCCAGGCCAGCG
GATTCCTCTAGCGGCGCAACTCCAACTGCAATATCAAAAAGACGGAAGTTGACACTGAAGTGAATTTTCACGGCCAGATACTGCGTCGGTTTGGGTTTTG
TCGGGGATGGGTATTGCCAGAGCTCCAGCGACACAGCCACGCTCTTAGCCCTGGCCAGTACCATCTTGGTGGTCAGAAACACGCTTTCCTGCAGTAGCAA
GATACATTTTGCCACTGCTTCTTCACTTGGCAATGGTAGTTTCTTGTCTCCCAGTAGTTGGTTCATGACGTACGTCATCCCTGGCTTCGTAGCAAAGTTC
AATGGCAAATTGTCCATCAAGGACATTAAGGCCAAGTCCTGCGTGAACTGTTCAGCATTAACCTGCACGGGTTGTACCCCGTAAGCAGAGCCCATGGCTT
CCCGCTGTTCCTTGGTCATGGCCACACCCAACGCCGGCGTATAAAAGGCGGCCGTTGGGTCTCTCTTGAGAGCGGCCGTTAGCATGCCAGGTGATCCTCC
AGCCGCGGCCACCGCAGCAGCCAGAGCTTGGGAAGCTGCGGGTGGCGCATACATGAACTCGGCCCCAGTCTGAGCCACGGCCTGCAGTCCGAGCTTCTGG
CGCTTGATATGGCGCTTGGTCTCTCGATGCTCCTCGCACACATTATTGGCCTGCTGGTGCGTGGGATCCGTGCGGCCGGCCGTACGCAGATGCGACAGAA
GGTTGGACGAATGGTGGCCCTTGATCACTCGATCGCAGAACTTGCAGATGGAGTTACCCGACTGGTCCTTCTCGAAGTACGACCACACGGCCGAGACGCT
GGCTGGTCCGTTGGCTAGCGGAGGCGCATGGCCAGCGGGCGTCGATGGAGCGGACGACGTGGCCGACGCAGATGATCCCTGCAGGAATTCGGCACTGGCA
GCAGGCACGCGCTTCACCATGGTGATCAGAAAACCGATACCGGTACGGTAAAGTAAAATGGCGCCAAAGGGAGACTCGAATCAAAGACGTCGCCTAGCCT
AGAAAAGATATTGAATGGTGTCTTCGCGACACGTCATCTCTCCTATAAAAAGAATAAAAGAGTGACATAGTGACATTAGGTGCAATCATTTCAAGGAGTT
CATATCGAGAAATGTATTGAAAACTAGCTTGAAGTGTTCGGTATCCGATCTTGTGGCAGTCCATCACTTGATCATGTTGCGCCACATTTACTACCATAAC
GTTGGATCGATAGAGCGCCGAGGCTTCTCTGGTTAGAACCGAATAGTTTAGTGCTTGTCACTCTCTGCTGAGCTCTGTTCTGTGTGGTTGATGCATGTAG
CTACTCGTGGAGCGACATCTGTCGGATTCATCGGTCTGGGCAATATGGGGTTCCCCATGGCGCACAATCTTCTGAAGGCAGGAGTCGACGTGCTGTGCTT
CGATGCCGACAGCTCCAATGTCGATCGTCTCGTGCTACTTGGCGCGAAACCTGCCACTTCTGTCGAGCAAGTGGCCACCCAGACGAGCACAATCTTCACT
GTGCTACCCAAGGATGAAGTCGTAACAAGCGTTGTACTTGGTGATAAAACGAAATCTGGATCGGGTCTGCTGGCTAATATGGCGCCTGGAGCGCTGCATA
TTGGCTGTTCCACGATCCACCCGAACACCTCGCGTTCTCTTGATACTAAGCACCGCAACGCAAAGACAAAGTACGTTGCAGCACCAATTTTTGCACGTCC
AGACGGCATGGCAGCAATGCAAGCGAATTTCGTCGTGTCAAGCTCCGATGCTACCGCTGTTGAGCACGCATCTCAGTGGCTGGACAAGTGCACGAACGGA
TGCGTTGCACCATTTAGTACTGAAGATCCTGGAGCAGCAAATGCAGTCAAGTTGTGTGGCAACTTCCTCATTGCGTCAGCTATCGAGTCTATGGCCGAGG
CGCTGTCGCTATTGGAAGCGAATAATGTGGACCGCGTGCAGGTGATGCAGTTCTACAGCAACACGTTCATGAACTCAGTGATCCACAAAGGGTACGGACA
ACGCGTGTCCGAGCGTGACCATCGTCCAGGAGGTTTTGCACTAGAGCTGGGATATAAGGACCAACGTCTGACCCACCAACTAGCTATGGAGTCCCAAGTG
CCGATGCCATTCCTGTCCACACTCATCGATCGTTTCCTGAGCGAGCGCGCTAAAGGCCGCAGTGACCTCGATTGGTCTGCCATTGGTCTTGGAGTCTGTG
AGTCTCGTGGTGTTGATGTTTCAGACGCCATTGACCGATCTCGTGCTGGGTCGCCACACCAAGAGTAAGATGGAGCTCTAGTATACCACCGTGTTTTGAC
ACATTAAAGTCGTTTCCCCTTCAATTTTGGCATCTTAGTCATGTAACCTTCAAGCAACATTCATCAAGCCATTTTGGCATCGCAAGGTCCAAGATGAAGC
TGCTCAAGAAGCAGATCAGCGAGAAAGATGGCGCTGGATCGGTGGTGCTGCGCGCGGAGGAGCCCGAAGACATGTGGCACATCTACAACCTCATCCACGT
GTCCGACTCGGTCAAGACGACGACGATCCGCAAGGTCACAGGAGAACTCTAGAGGAGGAATCGTATATCCGTACTTAATCGAATAGTTTCTCTTTATGAC
GCTTACAGGTGGTGAAGGAAGGCGTGACGGGTTCTACCAGTAGCCAACGTGTTCGTATGACACTACAGATCGAGGTACGACGCAATTTTATGCTAAATTC
AGGGTAAATGCTAACATTTGGGAGTAGGTGGAGCAGGTCAATTTCGATCCTGTTCTCTGCGTCCTGCGAATTAAGGGAAAGAACGTCATGGAGAGCCAAT
ATGTCCGGGTATGCAGCTGACAAGTACACTGAACGATAGAGGAGTTCCTGACGAGGTTGTGTCTGTAGATGGGAGCTTATCACACGTTGGATCTAGAGAT
GAACCGCGACTTCACGCTGACAAAGAACTGTTGGGATGTAATGTCTCTAGAGCGCATTGAAATGGCCTGTGATATCACCAAGCAAGCTGAGCTGGCGGCT
GTGGTCATGCAAGTCGGCTTGGCGCACTTGTGCTTGATCAAGGGTGATATGACTGTCATTCGTGCAAAGATCGAGACGAGTGTGCCGAAAAAGCGTCCTG
GAAACTCGGCTCATGCCAAGGGTACGGAGAAGTTTTACGAGAACATTGTGCGCTCCATTCGACAGCATATTGATTTCAAGCTCGTCAAGTGTGTGCTTCT
TGCCAGTCCGGGTTTCGTCAAGGATGATTTTTTCAAGTACATGGTTGAGCAAGCTGTGCGTCAGGATGACAAGCTCATCCTCGAGAACAAGTCCAAATTC
GTGTTGTGCCATTCGTCCTCTGGTCACAAGCATGCGCTTGATGAAGTGCTCAACGATCCGGCAATTCAGTCACAGGTGGCGGATACAAAAGCAGTGGAAG
ACGTCAAGTGCCTGGAGCGCTTCTTCAACATGCTGCATATCGACCAGGACCGCGCGTACTACGGCTATAAGCACGTTGTGCGTGCCAACGCGAACATGGC
CATCGAGACACTCATGATCACGGATGCTCTCTTCCGATCGCAAGATATTGCTACTCGCCGCAAATACGTCGATCTAGTGGAAAGCGTTCGGGATAACGGT
GGCACTGTGCGATTGTTCAGTAGTTTGCACGTATCAGGCGAGAAGCTAGGTCAAGTAAGCGGTATCGCAGCCATTCTGCGTTTCCCCATGCCTGAAATCG
ACGAAGAGGACCAAGACGAGGAGTCTGATTCCGAGGAAGAAGAGGAGAACGAAGATGACAGCGGGGTGGGCGACTTGTCGGTCGAAGCTCTTGGTATGTA
GAGGGAAATATTTCTGTGAGGAGATAAACGCATACAGTGCATCAAACAATGTCCTTAGCTGCTTGTGTTGTGCTGTACGACGAGGTTGGACACTCGTTTG
TCGAAGGTCTGCGACGTGAGTCGCTCTCCCAACGGCGCAAAAGGGTTCGACATGGCGTTCACGTACAGGCGATGCACCTCCGCGAAGAACTGCAAACACA
GTGGCAGTCAGTAAAAACTCAGAAGCTTCAGTCACATCTTTCATGGCCCTGTACCGGTCTCAACTCGGACTCCCGCACGGGTGCGTCCTGCAACACCACG
ACAAACTTGACAGACGTGTTGGTCACGTAGCCATAGACTCGGTAGTCCTCAATGGGACCGAGGAAACCCAGATACATGTCGTCTTTGGAGCTGGTGATGC
CTGCACTCCGTAGCTTCTCTTCGATCACGTCCAGCGACACATGGGCGATGTAGTGGAAGCCCAAGTCCTCACCTTCCTCGCCGAACGTGCGGATGTACAG
GGGGCTGTTCTGCACGGAAGTAACGAGGTAACTACGGGTTAAATCAGAGCTTATACTGATGGAGTTCTAGGCAGAAGAGAGAACTTACAGCAGCACCGAT
GACAGCGACACAGGCGATCATTATGGTGAAAATTGGCAATTGGGAATTAAATGTTGTCGGAATGTTGCTTGAAGAAATAATGGGTACAATGTACCATTCT
GACGTGGTCTATTGAAGTGAACTAATCATCGTATCCTGCATCCGAGTCTCGCGCGGTTGACGGTGGGGTATATTCTTGAGTGGCGTCGTCCAAATTTTCT
TCGGATTCTCGAGGAGAGCTCTGATAGCTGGTGGGCTCTACTGTCTCAGACGTTTTCGCTATATCACCTTCGGAATCAGCACCTTCGACTGCTGTAACTG
TGGCCTCTTCAGAAACCTGGCTTTGGTCTAGTTGTAGGTTGTTGTCAGCTATATACCCTTCTTCACTTCTACCTTGCTGGTGATCATTTGTCATTGCTGT
TGTAGAATCATGTGCACTTCCTGAAGTGGCAACAGTAGCGCTCGGCTCGCTGGTATCTCCGGTATGAGGGTCCAGGTTCCAGACAGATTTTTCATTACCA
GGGGAGCTACTCCCGGCATCATCACGTACAGTACCAACTGTTGATACTCTAGGGTCGAGGTTCCAAAAAACGCTCGTGTCCACTGTGTTGATAGTTGATT
CAATCTCTGCGTCTTCGGCGCCAGCAAGCAACTCTTGTGTTTGACTATGATCGTCATTACCGGATGGTGATGGATTGGGATCCAAATTCCAGGGACTTGC
ACCTCTTTCTTTGTCTGTAGTTGGGTCAACAACAGAGAACGTGTCTGGTGGGTTGGGATCTCCCCTGTTATTCGCGCCGGCGATAACGTTTTCTTCTAAG
TTGTTTGCCGATATTTCAGCTGGAAGCTCCTCACTAGCATAACGAGTGGAAGGCGGAGCCGGTCTGGAGACTGCCTCAACTACAGGATCAGGGTCTACGT
TCCACACACTCTGCTCATTTTCAACATCGTCAACTTCTGTGGTAGTCGTGTGAGTTTGGTCCGTCGATGGTACTGGATCTAAATTCCAAACAGGATTCTC
GTTTTCGACGTGGTGCTCAGCGTCATCAACTTCCGTAGTATTTGTTGTTTGAGCTGAGGCTGACGATGGGCTCGGGTCTAGGTTCCAAATTTTTCTCGTT
CCGGCGTCGTCGAGAACAGCTTCTTGTACTGCGCATTGAACATCCGAAGCTTCTGTATGTACATGCTTCTCATCTGTGGGAACGAATGGAGTCGGATCTA
GATTCCATACGTTACCCTCGCTGGGTACTAAATTTTCTCTTTGCAATACACCATCGTGTACTTCATACTCCTTGTCACTATCGACAAAGGAAACATCTGC
ACGTACATGCTTCTCTTCTGTGAGAACGGATGAAATCGGATCTAAATTCCATACGTTGCCCTCGGTGGGTTCTGATGCTTCTTTCTGTAACACACCATCA
TGTACATCGTCTTCACCGTCACTTTCGGAAACCGACGCAGCATCTATTGATGCATCTGAACCAACAGTATGAGGGTCTGCATTCCACACCACCCTGTCCG
TATGGGTACCGCTTTCACTCGGTAAATCTGCCTCGACAAAATTTGCCGGGTTGGGATCCGCGTTCCAAACGCTTTGTTCAACTCGACCAAGTTCTTTTTC
CTTGGTGTTGTCATCACTCGCATCAAAATCGTCATCCTCGTACGTCTTCTGCTTGGCTAATGCCTCCACATCAACTTCCACAGTCGGTGTTGCTTGCACT
TCTGACTCCTCTGGAGTGATCTCTTTGACAGCCCCCGTTAGCACAGAGTTTTCAACTGATACTTCCGCATTCATTTCAACTTCGTGTTGTGAGCTCCCCT
TCTCAGTAATGTCGGTGTTGTTACCGTTAGGTTCGTCTACCTGGTGGGGAGAGATTTGCTCCATCACAGGTTTGACAGTGTTGGCATCAACTTGTTCAGA
ATCATCGTGACCATTACTCAGTTCAACCCCTTCTGTGCTCGACAATTTCATCGGTTCGCTGCTTCCCAAGACGACGTTGAGATGTTCTTCGTGAAACCTT
GCGCTGTTGATGAAAAGTTCCGTCTGCCTCGCTTGATGCTCAATAGCTTCGAGCCTTTTGGCTTCACGAGCTGCTCGAATGTGCAAATTCTCCTCCAACT
CACATTCAACTTCCAGTTGAGCTAGGCGAACCTGTTTATAATATTCGGCTTCGAGTGCTCGTCGACGCGTTTTAGAGACAAAACCTTCCCGATGATCATA
CTTGACGAGTGGCACGACACGAACTTGACCTACAGCACTCTGTGACGAGTACAGTTTGTTCGCGTTTGAATTCATTAGACCACAAGTCGTTTGTCTGCTT
TCTGGACTCTTATCTCCAACTAAATTTAATGGATCCAGCTTGGTTTTCTTCAGCAAGGTGCCCGTGAAGTTTCCAGAACTATTCGCAATTTGTGGCACAG
ATGAAAGTTTTAGTTTTCCAGCAATCACAGTTGGTGAGGGAGCCGATGTAGTCTCTAGCTTAGCTCGGAGGCGCTCAATCTCCCTGTGGCATTCTTCAAT
CTCGATTTCCAATTCCTGGAAACGAAGAAATTTACTATGGTGCACGTGAGTAAACAACTACAGAACGTGATTAGCAAATAACCTTCCAGCGACACTTACC
TACTGTGTTTCATGCGATCGAGCTCTTGTCTTCGTTCTTCTGCAAGCGCTTCAGAAGTTGCAGCCTAACTAACCGAAAAAACGAAAACACCAGACTGTAA
CAACACATTATCTATGGCCACAGCAATGCTGCATAACGTTGTCATACCCTTTGCATGCATTCCGACACAAGACGATCAATCAGTTCTTGCTTGCGGGTTT
TGGTGGTTTTGGCGTTTTGTGGCGACCGCAAAATATCGAATGCAGCTTGTAGCTAACCTCATAGCACAGCATCATAGTACACAATCATACGTCATACTCC
ATAGTTGTCGATGAGTGTAGTAGAAAGTAATCATCGTACATCCTTGTCTTTCTTGCGCAGCGTTTCATGTAATCTTCGAGACGCAGTTTTCAACTGAAGG
ATCAGTGCATCCTAGTACACATTCCCACACTTTTTAGCTCTTGACAACACAATGCAGCATAACACCTCAAACATCTTCAAACCTTCTCTGTAAGTTGTCT
TTTGACAAGTACGAGTTCCTGCTTCGTATTTTCCCACTCTCGCCAGCCATCGTCCAACTACAGCAAAGCAAAATGTCAATTCGTATTCCATAACAAAAAT
CCACAGCTCTTTTCTCCACCTCAATCTGCTGATACGGAGTCACCTGCGGCTGACTGGCGCTCCCTCCACGTCTACTCATCAATCGCCTCGCCATCCCCAA
TTGCCAATACTCTACCACGTCGTTTCGCGTCCCTAGACTGTAGTCATTTTGAATGATAGAAAGTCGACCTGAAACGTCGTACCTTTGCTCATTTTCAGAT
ACTAGCCGACGATATGGGGGAGGCTCCAAGCTGGCAGCACATGTGGGGCGCCAAGGTCAAGATGCCCTGCGATATGGAGGACGATGTGCTTGAAGACGCC
ATCAAGCACGTCACATCTCGACTGGCCAAGTATGACACGGAGGAATGGGAAAAGAATGGCTTGACGGTGAGAAGCGATAGGATTGTGACTCCAAAGTATA
ATAGCTATTAAGCCACTTATTACGTTGCATTGGGATGATAAATGAAGGTGTGCGAAGAGATCAAAGCTCATCTGGACGACGCGTGGGATCCACATTGGGT
CGTGTGCATTGGTCGGAACTTTGGCTCGTTCGTGACCCACGTAACTAGGAATTTCGTCTTCTTCTACTACAACGAGAAAGCCGTGATGATCTACAAGGCC
GGGTAGATATCGAAAGTCGAAACCACGCGAAACACGAACATTTTGCATCAATTGATCAACCTTCATGGCATACTTCATAAATACTATCATTTTTGCCTGT
ACTACAAACTACAGTCTGTAGTGTGTGTAGCGTAGACACATTCCGCCAACCTGCCACTTCAACTTGATTGTCGGACGATGATTGGCTAAAATTTGAATTT
TCGCGGCAGCCAACAGTTTTTGACATTAGTCCATTGCAGCCATGGCCACGCACGTCGCCAAGAAGATGAAGGTGGAGCACGAGCCCGTCGGTTCCAGCGC
CGAGAGCAGCACAACCATGAAGCAGGAGAACCCGAACGACTCGGATGACTCGGATGACGAGACTGGAACTTCTGCCATCGCCCAGTTCCAGAGCGAAGAC
GTGAGACAATTGACACATTGACTTATTGACACAATCGACTCCAGAGACGTTAATACTGTTGATTTGAACAGGGCACCAATGTAGGACCGCAATTGGAGAT
CCCCATGAACTCCAACGTCCGACAGATGGAAGAGCTGGTGAACGAATTGCTGCAGAATGGCAAGAACCGCGTCCCGTACTCGCTGTTCATTGGTGAGACG
GAGGTGACAACGTCTCTTAAAGCCACGGTGGAAGAGTTGGTGCGTTGCAATTGCAGTGTCTCTGTTGGCTGAAAGGAGAGTTTTGACTTGTTGACGGTAC
TGTGTAGAAATTGTCGACGGAGACGGCGTTGACCATCACATTCCAGCCCCTGGCGGCGTTCCGTGTACGTCCTGTCACCCGTTGCAGCGACACTTTGCAG
GGACATTCGGAGGCGATTTTACACGTTAGTTTCAGTCCCGATGGAAAGAGATTGGCGAGTGGAGGAGGAGACGCGACTGTGCGTTTCTGGGATACCAACA
CTTGCATGCCCAAGCACACTGGTCGCGGACACAAGAACCACGTACTGTGTACGGCGTGGTCACCGGATGGAGCACGTTTTGCATCAGCAGACCGCAACGG
TGAAATTCGTCTGTGGGATCCACTTACAGGCAAACAGATTGGTCAGCCCATGAAGGGCCACAAGCAATGGGTGAACTCGTTAACGTGGGAACCGATGCAC
CGCAACTCAACTTGCGAACGTTTTGCCAGTTCTTCGAAGGACGGCTCTATCAAGGTCTGGAATGCTCGTACGGGACGATCCATTGCATCGTTGTCGGGCC
ATACGGACTCGGTGGAGTGCATTAAGTGGGGAGGCGAAGGTTTGCTGTACAGTGCGTCACGTGATCGCACAATTAAGGTTTGGGCGATGGAAGGTGATCA
CGTGGGCAAGCTTGTGCGTACGCTGATTGGACACGGTCACCGTATCAACACGCTGGCCCTCAATGTGGATTACGTTTGCCGTTCGGGCCCGTTTGGCCAC
AACACTAAGAGTTTCGCGTCGCGCGAGGAGATGCAGCAGGCGGCGTTGAAGCGGTACCAGGAAGTGCGTAAGGGGCAGCCGGAACGTTTGGTTTCCGGCT
CAGATGACTTCACACTGTTCTTCTGGGAGCCCTCAGAGAGCAAGAAGCCACTGGCGCGTCTCACAGGCCACCAGCAGCCAGTGAACCATCTAAGCTTTTC
GCCGGATGGACGATATTTCGCCAGCGCCAGCTTTGACAAGAAGGTCAAGATTTGGAACGGACAGACTGGCAAGTTCGTTGCCACACTCACTGGCCATGTC
GGTGCCGTGTACCAGGTGTGTTGGTCCAGTGACGCACGGCTGATCGTGACTGCCAGTAAGGACTCGACTGTGAAGGTGTGGGAGCTTAGCGAGCCGAAGA
ATGCCAAGACGACATTGTCAGGCCATGCTGATGAAGTGTACGCGCTGGATTGGAGCCCGAACGGCGACATGGTGGCGTCAGGCAGCAAGGACCGCACCAT
CAAGATGTAAGTGCCCTATATTGTTGCTGTTGAAGTTATAGTCACTAACTTCCCTCGTTTCTGTGTCGTACAGCTGGAAGCACTAAGTTTTGAATAGATT
TTACACTTGGTTTTTGTATGTTTGGAAGAGAAATCAATCGTACTTTAACGAATAGGCGCCAATGCTTCCCTCACTTCCGTTTTAGCGCGCAGCCAGCAAC
TGAAGTTTCAGCGTCATTTCGCTGCCTTTACTTGTTAAAACCAGAATGAAGCGTGGACGCGAAGAGGACTGCGATATGGACGCCGTGGGTATGACGCCAC
CACCATCGTCTCTCTGGGCCTCCATGTCTCCCTGGAAGCCGCCACACACGTCTATCAAACGCTGCCGAGACCGCTCTGTGCCTGTCGGTACGAAATATCA
TCCGCTGAAATTCATGTTTAAACCTAACTAACTGTTAAAACGTGCTTTTATTACTCTATCAGACGCCCTGAGTCGCATGATGTCCGCCGCCGTCACCAAC
GCGCGCATCAAGAAACACAGCAGTATCGGCAGACTCTTTGCTGTCAAGACTGAGACGATGCAGGCCTGCTGCGCAGTGTGCGAGAGCTCCAAGCGCCAGT
TCGTAGCCAGTCACATGCCTCGCTGTTCCCACTGTGAGAAAGCAATGGGCGACTGCTGCCGTCGTGAATGTGACACCTGCTGCAACGTCTTCTGCTCGCT
GTGCTCGACGCTCAACTGCGACGAGCAATTCGACCGCGTCTTCTGTCTCTCGTGCAATGAGGGGCAATCCAGGGGGTAGAGATCTACGTTGGAGGTTTTA
ACTAGTAATTCTAAACTACATGTTGGTATGTAGGTGTCTTGTGTCTGCAGCTCGTGTCTAACTGAACATCCCAGCGCCTGGAGCGTCGTATAGGAAGCTG
CGGACGATTTCGTATGCAGCAGCAGGTTGATCGTGAGGAACCATCTACACAGAACGAGGTGAGAAAGGAGATGCAGGAACTTTATAGCTGTACGTACGTG
GCCTGCGTTGTAGACTTTCATGAAGCTCAAGCCGTGGGAAGAGCGCACACGACCGATTGGTTGGTTTTGGAGTTTGTGCTCGGCGAAGCTGACGGAATTG
AACTCAGCTTGATATTCCCAAGTCAGATCGCGAGTCCACGTGTCTTGGGACAACCAATTGACGACGGTGTCGGCGTCACCACCGTATACTAGTACGCGAA
CACCGTGCTCAAGAGCTCGAACGACGTTCGACTCACTTTCCTCCAGCTTATCCATTGTTGACAACTCCGGGAGAGCATCAGAAGAACACACACTCCACTC
ATAAGGAACATCATCGAAATATGAGCTCACGTGTGGACTGTTGACGAATGTCTGAAGACGAGAAAAGCGGTAACAGAGTTGAAGGGCATCGTCAAGATGG
CATTCTCGACGCATGTCATACACGTTCCGACCAATGTTCCAGACAGAGGAGGCTGTTGCTCCTTGAAATTCTGAAAGGCTTCGTAGAGCCTCAGCGCAAT
CGGAGCTGCCACTCTGCGTGGGTACGTGACTTAAGTTACCTCCTCTTCTGCACCTTGCAAGCGCCGACATGAATCGATTGCGAATTGTTTGGATACCTTC
TTCATTCCAGCCTAGAAAGTCGTAGCCATACTCATTGGCTTTGAGGAATGGGATCACCGTGTCGACCCAAGCCATGGTCGACACAACGCCGTTGCCGATT
GCAATACCTTTCAACTTTGGAAGCGAGCTATCCTCATCAAGCAGTCTTACTGCCAAATCTGGTACGTAATGTCCTGCATAACTCTCTCCAAAGACGTAGA
AGTCGCTTGCTTTGAGTGTTGAATGCTGCCGGTAAAAATGCTGGAGGAACGTCCGCATGTCGTCAGCAGCACCTTCGAACGACCAAGGGTTTGTAACTCC
ATTATCTCCATCACTGTATCCTGTGCCTTTAGGCTGGTCGAGGTATATAACGTGAGCAAGTCCAGTCCACGAGTACGGATTGAACGAGATTGAGTCTGCC
TCATCGTCAAATAAACAAGGACCATTTTCGAATAGCAAGGCGACTAACCCAGAACATCCAGGACCACCCGAAAGCCACAAAATCACGGGGACGTCAGGTT
TCGTGGCGGACGACACGTAGAACACGTAGTAGAGACCGTTGAGCATGCCGGTCTCCTTGGTGAGATTCTCTCCACACAACGACTCCGACGATGGATATTC
ATTGCGAAAGTCATTTGCTTGGACGAATTGATGCTCCCCACCTGACAACATGCAGCATTTCGCAAATTGCGCTACCAAGAGCAAACACCAAGCGTGGAGC
TGCATGAAGAATGGCAATATGCTGACAAGATCACTAGTCGCGACCTTTGCCGTGCTGAAGATTTTGACTAGCATGAGAAGTTTGGGGTTCGTTACGCTTA
TCAAAAGTAGATCGACTGCATCGTGGCGCTAAGAGGGTCGTAAGCGGTGACGAAGACTTCCTCTTGAAGAGCACAGTCGTGATTTCCTTGCTGCTTTTCC
TCCGATGAATGGAATATGTGCTGGATCGAGTTGTTCCATGGGTCTTGAGCTGCACTAGGAGTGGTAGACGCTTTGGGTGGAAGCGGCTTGAGCACCTGAA
CAAGCCAAGTCAACATTAAAATCAACATTAGACTTGGTACCGACCACATTGATAGGTTTCCTGGCTAGACCTCATCCGGATACTTCTCCTTGGTCCCGCG
TTGCCCCAAGTCAATGATAGTTTTGAACACAGGATCCGCAGTTCGTGTCGAAAGCTGTGCCTGACTTTGTTGCGCTGTCTTGTTTCCAGTCGGAGCGAGC
ATCTTGTTAGAATATTCACTTGCTTGCGGATTGTCTTGAGGACCTGCACCTTTAAAACTGAATCGGTCCAACGATTCAATAACAGCGATCTGCTGCTGGT
TGGGTGCTCGCTTCAGCTTCTTCTGTTGCCGATGGCTTGGTTTTCCATCGTCCGAACGCTTTAATGGCATACTTGTGTCCTTCCTCGAGTTTGTCAACTT
TTTCCCATGGACACCACGATGACTCTGCATTGCAGCGTTACTACGAGGTAACTTCTCCCTCCTTGGTGTTTCTCCATTTACAGTCGTAGCATTCGATGCA
TTCAGCGATTTCTTGGCCGTTGGTTGTCGACATGACTGCCAACCTTTCACATCATACTCCTTCACCGGCTGTGTGTGCTTGACTTGTTGCAGATATCGAT
CCATCCGCTGCTGTTTGGCGTTCGTTTGGTGACTTGTCAGCGTTTTGATGTATCGAAGGATTCTGCTGTCCCCTTGTGGACCTGAATCTCTCTCTTCCTG
AGCAGGAGCTCCATAAGTGCACTGAAGCACAATATTCTGCTGCCAACTCATCACAACCCCAGGAACTGCACAACCACACGCAGTTAGAGCGACTAGAAAC
TCCCATGCAAGGCACTACCGATCTTACTTACCTTGACGCAGGCAAAACGAAGAGTGATGGTCAGCTTCAACTTGTATTTTTGAAATTTAGTGAATATAAA
ATTATGAGGGTTCACTTCAACTATCTATCTGTTGAACCATCTCTTCTTCTTGGACTTGTGTCGGCTGTAAACGGCAGCAGCGCGACGTCCTCGCCGGGAA
ATAGTGAGTGTTGTCAGCGATGAGTTTGGTGCTGTTGAGCTTGGTGGTTTCCAAGAGTCCAGTAGTGAATAGCGTCGTTCCGAGGTCATACCACTCATTC
CGCTTTGCCGACTCAGATACGTCGTCGTTTCCGACGGGATTTCAGTCTCTTGATCTCGACGTCGAGTAGCTGGCGCTTGTGAGCTGTAGTCGACATTAAT
GCTGCTCATAGGAATGTCACCTGCAGCAGAAACCAACCTATTTCCGTTAACGCGCTTCACTTCGACGTCGACTGGCTTTAACGGTACACTTCCGCGTCGT
GGTCGAGTAGCAAAAATGTCCTCATCATCCTCGTGTTCGTCATACTCTGCTGCCTTCTTTGAGTGGTATTGGGAGTCAACGGGCTCGTATTGAGCTCCTA
ATGTTGAGTAGCGGACTGACGGTGGGGATGGCAGTGGTGAATTGTGCACATTTCCCCTGTATCGGAAACTGCGAGGAGCTACAGCATCTGTCAACTGGAC
AGCACCATCGGTAAAGTTGATGCTTTTTGGAGGAACTTGAATAAACGTGCCATCGATGTCAATTTCACGATCATCAGGAACGCCCTTGATGTCAACACGG
ATGGAAGGCTCTCTCTCGCCATCTACATCGAAGCTCTGAGTGCTCGCAATAGTTGATGCTAGCCCTCTTGCTCCATCCACGTCGAAACTTTGAGTACTCA
AGACATCCGGATTGGTCGTTTCCACATTTTTTGAGGTAGCTGGCGGCTTTGTTTCGGATTGCCCCGTCTTAATCGAGTTGCGCATCATTGACGGACGGCT
TTCGAGTGTGAAATTGTGCCAGCGTCCCATGAAGCTACGCGACATTTGCTTCAAGTGTGTTTCCTTTGGCACTTCAGCATGGATGATGCGAAGCACGCGA
TTAACGTTGGAAAGAAGAGCATGCTCAACCTGCTCCTTATTTTCAACCAATCCTTCCAGGAACGCCAGCATCTGAGGGTAATACTTGAGATCTTTCAACC
AATATTCAGGGTCATCCTTCGCCCCGCTTTCTGTCAGTTCAGTATTGCGCGCCTCTAACACTCGACGAAGGGCTTTCAGCAAATACGGAATGTCAGGATG
TTGCATGGTTATTCGGCAAGTAAGCAACTCCACAAACTCTTTCGAAGTGATCTCTGGAAATTGCACCAAACGCCGAGCAATACGCAAAATGCAACGGTAC
GGGAAGCTTGTAATCAAGTGCTGATTACAATAACGCACCAATTTCACAATCTGTTCCGGCATGCCGTTGTCTGCGATGCTTTCATCAACATCGAGTGAAG
CTCGCAAAATGTGCGTAATGGCCATGGTATACTTGTCAATTTCATCGGCTGTTTTCTTGAGGCTATCCGGTGGATTTTGTAAATCGTAGCTCATTAGCTG
GTCAAGTTGGGTTCTCCACAACTGGAAAAGCAACTCTAGATTGTATGCTGGGTTTGTCAACTTTTCTGGGTCTGGTCGAGATAAGAATCGATCAATATAA
AGGCCTGCCACAAAATTGTGGGGGTACGGGATAAAATCCGTCTCTTCGTCAAGGAGGACAGAATCTCGCTTTGCTATCGATCGCTCTATCCGATTCCGAC
AAATAATTTGGTCGAGCTTGTTGCGCACCTCTGTACGTTTGTGGGAATTCCAAATCAAATCACTCTTCTCGTGGTTATCATCGAAGAATCGTGTCGCTTT
GCTAGGGTCCAAGTGAATTTGGTACACAATCGGGTAGGGAAGAAAGCGGCAAAGCCCACTGTACATCTTCTCTCTTAAAGCGAGATCTTTCATCAGTAAC
GCGTACAAAACTTCAAAGGCAGGCTCTCGCAATGCCTCAGCTCTGAGAAAGTGTTCGTGGAGAACGTTCTGCCTGGATTGAAGCGCGATACCCAATATCT
CGATCCATAGTCCGCTATCTTGTACGTACTCGGCAATAACTAGGCAAGTGTCACACAGCTCGGCCAAGCATGAAAGCGCATAAAAGGCTTGCTCGTATCC
AAGATGATCCGTGATAACCTGAAGACACCACGTGAACTGACAGAAAGGTGCCAGCATTCCCTCCAAGTTACACTCAAACCCGCATATTTTGTTTAAAATA
AGAAGCGCAAGTTCTTGGCGGGCCAAATAGTCCACATTTCCAAACTCAGCTTCCATCCCAGCAGGTGCATCATCAGATTCAGCCTTCGCTTTAAACCCGT
ATGTCGATAGGGATCGGCGAGACGATATCGAAACTGCTGCCTTTGATTTGTCATCACCATCAAACGGTAACAAATATCTGCCGAGCGTCGCCACTGAAAT
TGAGGCATTCACAGCGTCTACATCATCGACATGTTGCTCTAAGCATTCTACAATAGCGGGTCGAAAGGCTGGCAAGTCACAGAGAAGACTCAAGCAGTCT
AACGCTGGCAGTGTATCAGAATAAATACCGAGCTTGGGATCTCTGTTTTCGTTCAAAAAACAGAAAAGTGATTCCAAAAAATAAATTGCAGTAGTTGGAT
ACAGCGTGTCCTCCGTAATTGTTTGCGGATCCACTTCGGACTTTTCCAATAAGATCAGGAGATAAATCCCACCAACAAACGGCTCGGAACTGAGGCAATC
GTACATGTGGTTAGTTGCGCTTTCCAAAAACGATACTCCGTCACCATTAGGGTCCGTGCAAAACTCTTCCGTTAGTTGAGAGAGCTCGGATCTCGTGTTG
TCATTCCAGATGCAGGTTGGCTCACGAATATTGGACAGTAAAATAGTACAGAAGTCGTGCCCATTAGGTTTCTCGAGACAATCCAAGAAGTCCATCGGAA
GGAGGTTTGCTAAGGCGTCAAGCCCTGCCGATCGACTATTGCCGTCTGGACCTAAAGCTAGTGATCGGAGTGCTCCAAAAGCGCTCTCCAGCATCTCACG
CTCCTGTTTCTCCAAGGCAGTAGTGCTTTCCTGTGAGGTGTCGATTCCTGACGAACTCTCGGCTGATGCTAAAATCAAATAGAGACCCTTCCAAAACACA
CGCGTTGAAGCCATTATTTGTTCTTGCAGCTCATGGCTCCGGCACAGTGATGACGCGATTTCAAACGACATCTTTTGGATATGCCACGGCTGAATGTTCT
CAAAAGAAAGGATGACATCATCTAACAAGGAATACACGCGCTGGGCATACTTGGACTTGCTCGTCCCGTTCTGAGACGGGTACTCAGTCGCAGTGAAAAA
CGACGTATTGTCATCGTCCGTAAAGGTGCTAAAGTCGAATGCCTTCGACGGTGGTACGTCATTAGACGAAGTCTTGTTTAGTTCCAGAAGCGATTGTACT
CCTTCTTCTGATGCAAGAAGCAATTGAAGAATAGAGAACATGCTCTCTTTTGCTGCTACGTCGTGACTGTACGCACAGTCTTCCACCAATTCCAAGATTA
CGTCCCAACTTCCATCAATCATTACAAGAAGTGGTCCATTTTGTGGAGCAACCGTAAGCAAGCGCTGCAGCACTTTCATCGAAAGACCATGGAATTTTGA
CTCTCCAGATGATCGAGAAGAAAGCACTCGAATAAGAAGGTCAAGTGTTGACGACTCAAAAGAGAAAAACTGGAAGCCATATTTATCCATTAGCTGTAGT
TGCGATTTCAAAATGCGCTCGATAACTTCAATCGACGTCCGACCTCCGTCAGCCTCATTCTTGCGTTCAAGTGCAGCACAAAGTGAGTCAAATGCATGAC
GAACTTTGGCTAATTCAATCTGTTGCTGCCATAACTCTCGATAGCGTGTGCGTAAATCCGATGAAGAGAATGATATGTCTTCGCTCCAACCAAAGACCTT
GTATGCGTCTGAGTGGTCCACGTCCTCCTCCATACCATTCGTTTGACGTCGTGCTAGATATCGCCACTTTTCTTCAATACTTTTCATCATAAAAACAGGA
TCTTCTACCTCTTCGGCAGCTGAATTAGACTGGTCAAACGTTGAGAGGTAGAAGCCGCTGCAGTAGACATCTCCAGACAATTCCAGGTAAGAAATCGGTG
GAATCGGAGAGTAGTCGTACTTCGCTGTGACGCTTTTCATTAAGCTTTCTTTGAATACCCGGAGATGCTCGTCCATCATCTCTTGCAAATGCAACCTCAT
CGTTGACGACCAGAGAACGCGTTTGTCGTGCTTACGGCCGCTGTACACATCTGCAAAATCCTCAGGGGTCTCCGAATCCAACAGTCCGATGAGCGACTCA
GGCAGCATATCTGTCAGGTAACTCTGTCCCACATATCGCTCCGATGACCGCCTAATCCGATGGACTCGTTTCAGTAGTGTTGCCTCTGGAATGAAAGCAG
GCACCTTATCGGTTCCTCTAGGATTCGCAACCGTTGACAAAATGAAATAGAAAGCGCCATACCTGTAAATCTCTTGTAGCTCCTCGTCGCTTAGTGACAT
CAGCATCTCACAGATATACCTTCGTACGTTGGCGTTATTTACCAGAAGTAGTTGAACCAATAAAGCTAATGATGACGTATTAGCTACCACAGTATTCACT
AGAGGAGGCGGCCACAAGTTTTCGTTCCCAATGGACACTTTGCGCTGGTCTTTGACCATGAAGTTTCTTAGCGTCTTTAAGGCAAATGACGCACAACTTG
TGTCAATAGGTTCGTCAGTTAGCTCCATCCATCGTAACTCTGGAAACTCAAACATTGACTTCCATGTGTGGTCTTCACTACCTGAATACTCATCATGTGT
AGAGCAACAGCAAACGTATAGGGCGTCAATCTGGCGATGTCGGATGAACGGATCAGCATCTAGATACTCTTTCAGCTCATTTGCTGAACATGGCCCTTTA
ATCACACTGTTTTCTTGAGCTTCTCCCATAGCCTTAAGCTTAATGCTCCATCTGAGCGCGAACCTTGATTCATTGTATAGGGAAAGTTCTGCTATCGGAA
CGGAAGAAGTATCATTAACTTCCGATGTAATGAATGAATCCATCATCGGTATATCACCGTGGTCGTTCGTCATGCCACTGCCTATTGATGCTGTTAGGCA
CCTGTGTGACAACAACGACATGTACAACAACACTTGGATGTGATTCTTCGTACACAACTCGGCACACGTCTCACCAGACATACTTAGTCCAGACATTAAT
TCTATGATGTCTTGGATTTCACTTGCCAGGTACGAATTCCGTAACAGCTCAGTAAGAAATCGAGCTCGATGCTTTGTAATAGATCGGGCTTCGGGGAATA
TGCTAGCTAGCTCGATCAGGATCTTCAGCATCGAATGACCATGCTGTTCGCTTCCAGTTGCTCCAGTGAACTGCGGAAATCCTTTACTTCCGCTTGCAGA
CCAATCGTTCGTTCCAGATAGAGGAATATTGTTTAGGTGCAAATGCTCCAACCAACACTGGTAAACCTCATTGAAAAACTTTGCTGGGTCTTTCGCAATA
TCCATACTGGCAAAAAAGAGGCTGCTCGAATTTTTCAGCTTACCTCGGTGTGTTCCTGCTTCCATCGCACGAGCTATTTTGGCTACTTCTGCCAGCTGCA
AGGATCCATCATTTATCCTTTCCGTAATAACACGCAGGTAAAATCCGTCGACTTGAAGCTCCTGGGCAATGCTTTCGTACTTCACACAAAATTGAGCGTG
ATTCCACTTGGGCTCAATGTTTCCTTTTCGAGAGGCAATCGCCAAAGACAGTACAGCTGCTTGATTCGCTTTGAATTGGTGGAAATCTTCGAGTGCAGTT
TTGAGAGCAGTTTTTAGTTCACCTCGCGTTAGTTCATTCCAAATCAAGTCTGGAAGCATGAAATCCTTCCCGACCATGCTCGATAGGAGGGCCATGTCTG
TAGACGATTCTCCCGGGTAATTCATCCGTGAGGGATCTTCCTTGACTCGAATTTCTTTAACGGAACCACTAGCAAACAATGTTCCGATCTGAAGCTGCAT
GCGACGAATAAACCACTCTGATCCATCAGCTTGATCCTGAAATTGATGCTTGCTTTTCCTCCTCGCAGATTCGGTCTGGCGAGCTCGCTGCTTCTTTAAT
AGTTTCCGCACCATCGTGCTCGATATCATTCGAATAAATCCATGGGGAAGTATCCTTACAAGCATTTCATGGGAGGCCTTGTGATGAGTCACCCAGATGC
TTGCGATGTACTGATAGGTCTCCTTTGCGTTATCAGAGGGGTGAAAAAACGCCTTGTGGAGATGATTGAGAGTAAGACCGGAATCCAGCGCTACGTCACA
AATGCGTCGTCTCACCTTGTGATCACAGTGGTCAACAAGGACCTTCAGCACGCAAATAACAGCAGCAGCCAATCCTGCGTTCACGTTTTGAGATGCTAGC
TCTAGCAACAGTGCATACTTTCCTCCAAGCGCTTTCACAATGGAGTCGAAGTGATTGTTATCGGTACTATGGCGAGATACGACCAGTACATCCAGAACCA
GTTGTAGCATGACCAAAGTGATGCTTGGGTTACGCTGTTCCAGAAGATCAGTCAATAGCGAAATAAGCTTCTTATGCTCAAAGACTTGATAGCGAATGTC
TTTTTCAGCTACTCGATGTGCATTTGATCGCGATTTGTCAGCGATCAGCGAGTGAAGTGCGTTTACAGCCCACACAGTCGCAATCGGATCACCAGATACC
AGCACTTGAGCCAGAGTTGGAACCACAACCATGGCACCACCATTTGTCTGTTCCATTGCAATTCGGTAGCAGCCGTCATTGACACGACAGAACGTATCGA
GAATAACACAAATTTCATTCGCACGAATCGGTGGTTTGCAGGAGTGTTCAAGCTATACCAGTACACGTAAGACATCAACGTTAGCTCGGAAGCGAGTAAA
ACAAAAGTGACATGTCACTTACCATATTATTGATGCCATGAAGTAAAGAGCCGAACGATAGCTTCTCCAAGCGCCCACGCATTGACTTCCCCGCAAAATC
TTCCATTTCGACATTCATATTTAAGCTCTCGAGAGCAAAGGCGACCCTGTTTGTCGCAGACGTAATACTTACGCTTTCTCCACTCATCATTTCAATCTCC
TTCTCCAAAACAACATGTGCTGGAATGTAGAGCCCGTCATGGTTAAGATAGAGGAAGCGTTCATGCTCATCATTTAACAATACCCTGGGAAACATTCTCG
GGTTCAAATTAGAGAAATCTCGACTTAGTGATACATCATAATTGTCGACGTAACGATATCCGTCGATTAACGCCGCAAGAAACTTGTCGATGTCGTAAGG
AACGTAAACCACACGACTGCAATCCGAAAATTCCAACGCAACCACAGCCTGTGTTTTGTCACTTTCCAAACCTGGAACCACTACACGCCTCAAATTCTTC
AAATCATATATCTTTTTTGAGCTGTTGGTGAACTCTTCAATAGTTCCGTCTACAAAACAAAGCTTTTTCTTTCGCAGGTGTGTGGACCCATGCCGACCTG
TTCGTCTTTGAACATCAAATAAATCATTTGATTGAAAAGCTGATTGGTCCAGTTGACTTTCCACTGGATACTTTGGGAGCTTGTCCCGAGTTTTGAACCG
AAGATGAATTCCAATAACACCAGCTAATGTCTTCATTTTTTCCACCATTTCACGACATTGGTCGGAATAGATGAACTTCAATTTGCTCTTTGCTGTGAGA
ATGAACGCATCTGGAATTGCTGTCGCTTGAGTAATTTCTTCAATTGTGCGATATTCAAATTCATGAGTATGCTTAGTCACGATTCGTACAGCAATCAGAG
CTCGTGGGGTCAGATAAAACTTAGTCTTTTCTCGTTGTCCATTTGTTGTTCCGATGAAGCCACTGAATTGGCAGCAGTCAACACTGTATACGCGCTCAAA
TTCCTCAAAACTACCCACCAAATGACTCATGAGTTCCTGCAAGAAAGTATTGCGGCATCGATAGCGAAGTCGCAAAAACACCGGATCATCATATTGATCG
ATTCCCATCTTTAAGGAACCACATGCTGCCTCGAGAAATTGTCGATATTGCCGCAGTAACACTTCTGGGTTCTGGACAACCACCACGTTAGCTGGAGCGC
CCGATAAATCACTTGAAGAAGATGCTGATGATGAAAATGTGTTGTTTCGGCTCGAACCGAAATGATTTCGTCGCGATGAATATGCATGTAGAGGACGAGA
TGACAATGGAGCCACCACTCCACGCTGACTTCCTGGACCAAAATTCAACGTCTCGCCGAAGCTAAGAGTTTGCCGAGGAACCTTTCCATCATTTGATCGT
AATGGGGAGCCCATATTACCAAAGTGCAAAAATGCTGGATTTTTCGTCATTCTGCTCAGAATGCCCACACAGGCCTCCACTGTACCCAAGCCAGGAAAGC
TGAACAAAATTCGCAGCAGCATTCGGTATTTGGTCGCCAGGTGCTGATAAAGCGCTTCTGAAAGTTTCTTCTGCTTCTCGATATTTGCCTTTACAAGTAA
TAAAATAAACTGGCACAATTTCATCGTCGGCAGATCAGATAAAAACGTACCCGTCTACACAACACACAACGAAACGCGTTAGATTATCATAATGCAGTTG
ACAGTCATTAAACGTCCGACTTACATGGGTATCTTCGTCTAGCAACGAATGTAGCGTTGTCATGAAAAAACCATTGGATAGCAGTAGTTGGCGACACTGT
ATCTTATGGGCTTTGGATCCCATGACCCGGCTTAGTAGCATGAACATCCAGTAGATAGCAACCGAATCCTTGCTCACCAAAATCTTAGATATTGTACCAA
TGTAATCTTCGCCTCGCTAGAACAAGATGCATATACATTTATATGTTACAACAAAAATAAGCGGTCCGTACCAATTGCACATGTTGAGATATCAAACAAC
GCACCTCTGTCAGAATTTTCATGAACTCGTTGATGGCAGGTGGGGCAAGCGTTAACCGATATAGACACTGAAGGTATGTACTCACAAAGTCGTGCGTCGC
ACCGTGACGGCCTACAATGTCATGGAGCTCACGTGCAAGCACATATAATACCTTCTCAAAAGGCTTGTTCGGCTGTGCAATCACACCGGAAGTTGGCGTG
TTGGCATTAAGCTCTAGCGCCAAAGAGTGCATCTCCTCATCGAGGCCACGAGGAAGCTGCCGTTGAGTACGTGCTGTCTTACGATATCCATGCACTGCTA
GCAGCTGCAATATATTTGCTTGCGCGACACGGAGCTCGCGATCCATCACATTAACATTTGACAAAGTATTCGCGATTTTGTTGCCTTCTTGCAATATTAT
CTTGCGAGGTATCATGCGTACCGAATCCGGGACATCCGTCACTTCCACACCGACCTGATAATTTCCAAGCGCATGACAAGACACCACCAATTCACACACA
ATTTTCTCTCGCTGAGCAGAATAGTATTTGCGCTTGACTCCATCCACATACACAATTTCAAACGCCTGGAGCGTATCTTGGTACATGATCAAACTGTAAA
TGCGCGACAGCGGGCGGCTAGAAATGACCGTCTTGGCATCTTCGTACTCTGTAATGTATTTTTCCGAGACGGAGAGTGTTCTCGGCGCAGCACTAGACTC
GTTCGACTGCGAGACCTTTAGAACTTGGTACTCGAACGACACACTGGTCGTCAAGGACGCTTTGCCGTCGTCTTTCAACGCCGCTTCCATGGTTTTCTTG
CGATATTCATTGATTTGCATGCCGTAGGCTTTCATGACTTTGTTGATGACTTGTGCCAGCTCTGTGCGTCTCGGTACAATGAACAAACTCGAATTGTCTG
AGTGATTGAGAGCAATAGCTTCATGGTCATCACAGATGAGATCAATAGAGACCAGACTCGTGTACGGAATGTGGCTCATCAAGTCTCCCTCCGTATCTTT
CTGGTAGATGCCATCAGGACGGACCTCCACAACGCACGTGGACTGCACGCCGCTCTTGTGGTACTTGAGACTCTGGAACGTGTGTGTCTGCAGCTCTGTG
GGTGGAGGCTGAGGCGCATCGGGCATCTTGGCATGATGCTGACTGCGTAGACGCATGAGGCAAACCAAAACCTCCATGCGGAAGTGGCAGCGATAAACTG
TCTTCTTGATGCGGTGGCGTGGTGTGTGGATGACGAAATCCGTCTCACCCTCCAGTACGCTGGCACCGTCCACATCCTCATATGGCCACGTATTGGTCAC
TTGTTGGTTCTCGCGGTCCAGCGTCGAGAATGAGTACTCGCCGAAGCACAGCACACGCTCCTTGACCACGAAGCTGCCCACCTTGTGCACCATGAAGCGC
GCCACCACGCGCTTCCTCTCCATCGTAGATCGGCCAGTTCTGGACGCTTGCTCTCTCTCTCTTGCTGCGACTTGCCTTGTGTGCTAGCTCTGGATTCTCA
GACGATCTTCTCCACCTCCGCCCTTGATAAAGTGACGAAGCGGCAGAGAGCGCGAAAGGTCGCGAGCTACAGCGTGGGCTCAACTAAGTGCGACGACCTT
CATTCCTGAGGCAACTTCAACTCACATGTTTCGTTGCAAACTTTGACTCGAACGGAGCCTGACGATGGCGTTGATGTCGCCTGGTACGACGGCTGCGAAG
TGGTAGAAGGTGTATGTGTCATACGATGACATGTCATTGACTGTCCCTAGGAGCAACTGCTGTGCCGAAACATCCTTGGATTCCTACCATTCAGGAATCA
GTCTAGGACCTGAACCTATTGTGCTGGTGCTGTTGACATCCATCTTGCTCTCTATGCAAAGCAGTTGACGGAGGTTGTGGCCATGTTCGAGAGTGCTTTC
TCTGAGTCTAGAGATACTGAAATGCTAGGGTGGTCTACACCAATATTATGTGCAACACCGATTCAGCATACAATTATTACAAACTTATTCACACTGCAGA
TTTCCTCAATTTCAGCCAATCCAGCAGCAGACTCTGTGTGCGGCTCTGAGGGCCTCACAGACGCCCCACCACCAGAAGCACAGAAACGCGTTGGAGCTGC
ACCCCACCTCTCTATTGCCCTTTAGATCGCCGAGATGCTCGCATCGTCGTCCTCCAAGCTCGCGGCCCGCGCGTCGCGCTCGCTGTTCACCAAGGCCAGC
GCCATGCCCAGCGTGGCCCTGAGCGAGGAGTTCCCGGCCGTGCCCAAGACGCAGCCGAAGGCCGCTGCCGCCCCCAATCTCACGTCGTCCACGGCCTCGT
CGGGCCTGACGCTGGGCTCGGACGACCGCGCCGCCCACGTGGCCACCATCGGTGTGCAGCTTAACACGGGCGTGCGTGATGAGAGCGACGAGACTTCGGG
TGTGTCGCAGCTATTTACCAAGATGGCCTTCCGCGCCACGCAGAGCCGCTCGGACCTGCGTCTGTACCGCGACATTGAGGCCATTGGCGGCGTGGTGAAC
GCCCAGGCTGGCCGCGACTTTGTGCGCTACAGCGTGAGCGTGCTACCTGACCAGCTGGAGGCGGCCGCCGAGATCCTGGCCGAGACCACGCTGGCCCCTA
AGTTCGCGCTCTACGACGTGGACGAGCAGAAGAAGGTGGTGCAGGCCGAGTTCGAGAAGATCACTGAGGACGCTTCGGCCTCGCTGCTGGAGGGTGTGCA
CGCCGCTGCTTTCTACGACGACTTGACGCTGGGTCGCTCACTGGTGGCTGAGAACCTGAACACGCTCAGTCCCGAGGCGCTCTGGGCGTACTACGACAAG
TACGTCAACACGTCCAACGCCGCTCTTGTCGGTGCCGGTGTAGCCCACTACACTCTGACCGACCTGGCCAACACGTACTTCGGCTCGGTCGCCAAGGGAG
CTAAGGCTGCCAGCGCCTCGGCCAAGTATGTGGGCGGTGAGACTCGCGTCAAGAAGGCGGGCAAGTTCACGCACGTTGCTCTGGCGCTACCTACTGTGGG
TCGTGACTCCGCCGACTTCGGTGCCTCGCAGGTGCTGCGCGCTCTGTTGAGCCTGCGACTCAACAACAAGAAGGCCTCGGCTTTCCTTTCCAGCTACAGC
GATGCCGCTCTGGTGGGTTTGTCAGGTTACGCTGCCCCCTCGGAGGCTGGCGCTCTTGTGGACTCGTTCGCTGCTGAGCTCAAGAAGGCTGCATCGGCCC
CGGCTACTAAGGAGGAGCTTGCTGCCGCCAAGACCACGGCCGCTCTGGAAGCGTTCGGACAGTACAGTACCCAGGCAGGCACTCTGAACCGTGTGGGTCT
GATCACCACGGGCTTTGTGTCCAAGTCGCCATCGGAACTTGTTGAGGGTGTGACCGCTGCTAAACTGCAGGAGCTGGCTCAGAAGGCACTGAAGGCTACG
CCTTCCGTGGCTGCCATCGGCAAGCTGTCGACTGTCCCCCACGTGGACGCGGTTGCCAGCAAGCTGCAGTAAACAACCAGGACGATCGATCAAGAGTGAG
GTACATACATCAGTTTAACAACCCGAGCTTTTGGTGAAGCATGTTGAAGTGACCTTGGAATTGAGTGCAGATGAACAGGACAGCGTCGAGTGTGGATGCA
GCGCAGTGACGTGGTAGAATCTTCGGGTTAGGAAGGGGAAATACAGCGCCAGTGAGGCGGAGTGAGGACTGCGCAGCTAGCCTAGCTCCAAGGTGATGAA
GCTTGCGAAAAGCACACTAAATGCAAGAAAAAGAACCAACTTTTTAACGACAATGCTCGGTGAGCGGAAGCTGGTGTTTTGTCTCCCGATTCTGGTGATT
CGAATCAGTCACTTAAGAGTTGGCAAACGACTGCAGCAAATGAAGGT