Description :
From Genome Similarity Track
Location :
Scaffold_59:50830- 59921
Transcript NameFunction/comments
Phyke_g2741hypothetical protein PHYSODRAFT_309959

Sequence
9091 bases(100 bases per row)
GCCATCGATGAGGCCTCCACTCTGACCTTCAAGGAGGAACTGAGTCTCCAGGCGGAGCTCACGACGCTCGACAGTTTCCAAAACTTGTTCCGCAATATCC
AGTCGCTCGTGACAACCACTCCGCAGCTACTGCACCACTTGCCCAAGGTCGTGAAGCGTCTACAGacggagctcaaggaggcgCGAGATGACACTGCAGA
CCTAGTGGTGCAACGACAAAGACTCGTGCCTGTGCTGAAACTGGTGACTGCATTGGCCCGGGAACTGGGCAAGGAGTTCTACCCGCACTTCGCTGGAATA
TTGCCGCTTGTGGTGGCGGTGATCGACACGAAAGACCCAGAACTCAGTACACAAGTGTTCAAGACACTGACCATGGTGTTTAACTATCTACGAGTGCAGT
TGCTGGCAGATATGGACTCGGTGCACAAGTGCTACTTCCCGCTACTGGGACATCCGCGTGAGTTTGTGAGGAATTTTGCAGCGCAGACATTGGCAGTGCT
GTTGCGAAGACTGGAATCGCCAAAGGCGATGCGCAAGTACCTGCGTGCATTCTTGACGGCGTTGGTGCGCGGATCGGGGCGCAATGATGAAATTCTGAAG
AACGGGTCGGCTAAATTGATGTTTGCACTCGTGAAAAATGTGAACCATGGCTTTCACTCGCGGATGCGTGAGGTGTTTTTGTTCCTATTGGGTTCGTTCA
GACCGAAGACAGAGACAGAGGCAGAGACTGTTGATGAGAcggaactggagcagcaggaagctgtGTTTGAGATTGTGGAACAGACGTGCGGACTCATGAT
GAAACACACAGACCCTGATCATTCCGGTGATATGCTGGAGtacctggtgctggtggtgaccaAGGTGACAACTCTTCGTCGTGAAAAGGATGGTGTCCCC
ACTGAGGCGGATGACTTGTATCTGAGCCGTGTACTTaatctgctgctcaatttCTTCATTTCTCGGTTCGGTAAGCTTGTTTCGGGGGCAAGTAACTCTG
ACGACGTGCGTGTGCCCAGTGTGCACAAGGTATGCGCATCGCTGGTTTCGCCAGAAACCAAGGTGCTGATTTCGCGCAACAGAGCTTTGCGGAATGTATT
GATGAACACGTTTGAGGTGGTGTGGCGATTGTACCCTGCCGAAGACACCGTAATTTCCTCGCAGATAAAGTCAATTTTCGACGTGGTAGCAGACGAAAAC
GACCAATTGTActggcagcagaagctgttggactttgtggacaaggtgctgcagaGTAGCCATGTTACCGTACACTTTGTTGAAACGTTCCTGCTGCCAA
ATGCTCTGAAATTCGGACTCGACACGCTTGCCAAGACGGATATAGGCGCATTTAGCTCACTGTTGTGCAAATTGGGCAACTACGTGGCAGAACACGAATA
TGATATTAGCGAAAGCGCATATATCGTACcctccaacagcaacagtcgCCGCTGGTTACTTTCGTTCAAGGATATTAACGCTAGCGCGGacgcttttctt
cttgaagcaGGGCGCAATGTATTCAAGAAGTGCTTTGAGAATAAGCATGATACAGAGGCGTTGGCTGTGAGCTGGACATTCTGCAAGTCCTTGGAGCTGG
TGCGCGTGGATGACAAAAAACTGATAGGCTTTCTAACGCCTCTTGTCACGAAGTGCGACAAGCAATTGAAGAGCGAGGCATCTACGTCGGCTTTTGCCAC
ACTTCGTGCTGAACTCtggcaggtgcagcaggtttCCAGGTATAAAACCAATAGTGCCCAGTTGACAATTGCGTATGTGGAACAGGCGATTCTCGGCAAG
GAAGCTTCGTTCACGACACTTTCGACTCTGTTGACGCTCATCGATATGGAACCCGAGACGTACCAACATGAGGTGCTTGCAACCGAGGCACTGCCGAGCG
TGGCGAATTCACTGTTCGCAACCTTGCGCTCGCCGGCACATGCGCTTCGATTGGTGACCTTGCAGTTGCTAGCTCGGTTCAAGCGTTTGGAGTTTATGGA
CACAGGCGAAGCTACACTCTCTGGCCCTTGCGATCTTCTGGATGTTAGCGTGGAGCTTGAGCGTGCCTGCGAAAATGTGAGTGTGGCCACTGAACGTGAA
GTGATGCGTTTGTTGACACGAGTGAAAATTCTCTGTCGGTCGCCACAAACTCCAGAGCTGTACAAGAAAATTGCCTTAAATCATTTGCACGGGTTATACC
ATGTAAAGTTTTCCATAATCTGGCCTCACATTGCTGATGCGGTGGAGACAGCAGCGCGTCAAAATTTCAACGATTTTTGGCCGTGCATTAGCGCTGAATT
GCTAGCAGCGTCAATCCGGCATGAAGACCAGAATGGACGGCGTGACGAAGGATCCAATGTCCCGAGCGAACATAACGGCATTATCAAGGAATTTGAGCGA
GTGTGTATGCTGGAGCGGGGTGAGGTGCCAGCGTCCAGTGCTACCGATGCTGCCACGCATCACACACTACTTTGGAAGGGAATGAGCAAGTTTGCAGACC
TGGTGGAGGCTAAGACCAAGTTCATGGTGCCACTCTTCCTTACTTTTTTACGTGACCAGTATCGCAACATTTACACTGATGAGCTGGACGCTAATCGCCT
AGATGAAATTGACCAAGCGCTTCTCAAGCTCGAAGAAACCATCGGCAACGCTGACGCGGCTTCTCCCACTTGGAGAACTCCTATTGAGTACCAGGGCCTC
ACGACGAAGACGGTGCGAGGAAAGTTTGTGGACCAGCTGAAGCTTTTCTCAACGTTCCGTAACATGAAGGGTGCATATGCACAACAATTGTTGCACGAAC
TTTTCTTCGACCTGTTGATGAAATCGGATGAAGTGGTTTCGAAGCTGGCGTTGCAGTGCCTCTACGCCTTTGGCAGCAAGGCTCTTGTTTCATACAAAAC
GCAGTTGAATCGTCTGGTCGACTCTTCTTCGTTCCGTGAAGAACTCACGAGCTTTAAGGTgggcgatggagaaggtgtTGTGCTACGTGAGCATCGCGGA
GAATTGCTGCCCATATTACTGCGTCTGCTGTACTCAAAATGCGTAAGCAAGAAGGGTCGTAACAATGGCGACACAGTGGCTGCTCGCCGTGCCGCCATCC
TTTCATATCTGGCATCACTAGAGACGCCTGAGCTTGCGAGCTTTGTGGAACTTGTGGTGCGCGCATTTGGCGTTACTATCGAAACCCCGGAAGTTGTGGC
CGAAGGAGCATCTAGCACGGTTGGTGTGGTAGAGTCTGTGCCTGCTGTTGCGCAAGTGCAGCCATCGCGCATTTTAGGTTTCTTGAACTTGCTGGAGGAT
TTAATCAACCAGCTTGGCGTGAAGCTGGCGGCATTTGTGCCGCAAATCGCCGATGTTTTGCTAGCTATTTTGCAGACCAGCATCACCTCcaaggaagatg
atgattcaGCTATGGTTGGTGACGGCGACAAGGAAGAGGATAGAAATTCACTGGAAACTGCGGGGTCAAAGCGAAAGGCTACTGATGCCTCATCGACTTT
GGATATCTTGTCCACGTCTGCAtccatgaagaagcagattcGTATGCTGACGTACCGCCGACTCGCAGAGTTAATCGACACGGTAAGCAAACACTCTCAT
GTAGCCCATTCACTGATGCTCTTCTGTGTTGCTTACCTTTGTTATTCTGATTTTGTGTAGTTTGACACTCTCGTATCACTTCAACCTTGGGTGGTAGCGC
TGCTGGAAACCTCGCACGAGGCCATAATGCACCTGCCGAACGCAGTAGTGGGAGCTGACAAGGCATCAGCACTACTGGAAATGCTGGTGGCGACGGGCCG
TGCTGACAGAGCACGCCAGTGGCTTCCTGAGCCGCTTGTACTTAGTGTCATTACGTGCTTGTCTGCAGGTTTGACATCGACATCGTCTTCGCCTTCTCGT
GGAATCACACCCGAGATTCTGGACGCGGTTCTTCAGTTTATGGATTCGCTGCTGGACGGAGACGAATATTTGCTGGGCGagaacgatgaagacgagtCTA
TGACCACGGCTAAGGAGGGTAGTAGGACCCTGTTGGTTCGACACATTCCTTTTGTACTGGAACAGTTTGTGCTGCGCTTCCAGGCCAAGGCTGCGCGCTA
CGCAAGCGATCGCTACGCAGGGTCGTCGAAGAAGGAGCTAGCATTCCTATGCCGTCTCTCGCACCATTTGAATAACTCAAAGGGAGACGTTGCGATCGCT
GCACACGATctgttccagctgctgctgccatttctACTGCGCAACCACCAGACCACACCCAAGGACAAAGACAACTTGTTGGAGGTACTGGCAAACCTAG
TGCCCAAGCTCTCGGAACCTAAAAAGCAtgtgcttgctcttgcacGGCTACTAGCACCCGGACCGAATTGCATCGCCGATCGTGAGCCACGCCAGAAGCT
TGTGGCTGTGTTTACGGCTCTCGGTGCGCACTCTGCACTAAAAGATATTGCACCTGTGGCGGAGTTACTAGAGGAACTCAACGCGTATGACAGCAAACGC
ATTGAGGAGACTGACTATGAGCGCCGCCTCATTGCACTGAACCGGATAAACACCACACGTTTTGCTGGATTCACGGACGAGACTCACCTGCTGGCACCTC
TCGTGGCGCAATGCCTGCAAAGTATGCATGACGCAGAATTTTCTGTTCGAAgtggtgctcttgctggGCTTACGACCTTCTTAGAACTGTCAGCGGAAAT
TGGAAAAGAGAAGATGCAGAAACAAAACGATGACGTGACCTCACCCGTGCTGAATGCGCTCGAGTCTCTGGTTATGCCTTGCATACGAGCAAGTCTGCGC
TCAACTAACGAAAATGCGCGGCGTGGGTTTGTTACATTGCTTGGATCACTGGCAGACCATCACGAAGCATTTACTGGGTTTGCATACGTTCCAGCTGACC
TAGTGTTGGCACGCAACAAGGAAGATCCTGAAGCTGACATCTTCTACAACATTACGCACATCCAGGCACACCGCAGGCGGCGTgcgctgcagcgccttgG
TGCCCTTATGGACGACATGGCAACTAAAGCAAATGCCCAAGGAGAAAAACAGGCtgaagtggatggagaacCGTTGTGGTTCTCGAACTCGACTGTGAAT
GGTATTATCCTGCCACTGGTGCTTCACTTCGTCTATGAGACGCACGCAAAGAGCCAGGAGTCTTTGCGTAGTGAAGCTGCGGCCTGTGTGGGAAGTGCTG
CTGGGCTATTGGGTTGGTCACACTATCTAGCGCTGCTGCGGCGACTACTCAAATCCATCGACGGGCATGTTGAAATGGAGAGTGCTATCATTCTATCAAT
CTGCTCCGCTATCGACCACTTCCACTTTGAGGCACCGGGAGTTGCTACTCAGTGGCAATCTTCTGAATCCAGAAAAGAGCAAAAGGACAAAAAGCACGAA
CCGACGACGGAAGATAAGACGAATGGGGTACCCTCAAAGGTTCAAGACAACATGGAGACGCAGGTTCTTCCCATGCTCTACTCGTACTTGTTCAAGGGGG
TAGACAGCAAGAAAAGCTCAAAACCCAAGGATGATGACGGGGAATCGTCCTCACTCTCGGGGGAGACTGTGTCAGTGCGTGTGCCACTCGCACTGGCCAT
CGTGAAGGTGTTGCGTCGACTGCGCGCTGATACATTCCATCGCGAGCTTCCTAAATTGCTGCTTCGATTCGCGAACATACTGAAGAGCAAGGATGAAGCC
GTACGTGTTTCAGCCCGTTCCACACTTGTGAAGATCGCTGTGGAGTTAGGCGCACGGTTCTTACTACCGATtgtcgaagagctgcgaCACACGCTACGTG
ATGGCTACATGGTTCACGTGCTGTCATTTACCGTTCATGCACTCTTGGAAAAACTGCCAGATATGCTGCAGGCTGACGGAGAGTGTGGTCTTCCTCGTAA
ACCACAATCCCTGCTCCTTCTCCCAAAAGACAAACAGCAAGAGGCACAACAAGAGGGTGCATTTGCGTCTCCGCTGGATGCTTGTGTGCCAATTCTGATG
GAGATGCTAACGGCGGAGCTTTTCCAAGGAATGACGACTATTGGTGAGGCTGCGGAGGCAGCCGCTGGTGGCGTCGAACGCAAGTCTGCCCACAAGTCCA
AGATGAAAGAGGCGCGTTCAAGCAGTGGACGTAGCTTGGACTCTCTGGAGTTATTGGCTCGGTCTCTTCCCTTCTTGCCCAACCCGAGCATCCATGCAGT
AGTAAGTGCGCTTGTCCAACGCTTCCAAGTCACAGATGCAGGCGCCCAAGCTACGGCTGCACTGCAAGAGGCGTTTAAGCGAGTGGCTATAGGACTGGCG
AAGAACCCTGCTGTGGAGCCATCTTACGTTTTCCTTTATGCGTACAACGTGCTGAGTTCCTCCCTCGAGAGTTTTAGACCGACCTctgagagagagaagg
agCAATATGCTGCGGGAGGTAGCAACACGGAACTGGTGACCTCTTGGCTCGTGTCAGAGAAGAGCGCCGCAGCCACAAAGCTACTTGCAGCGAGGGTGAA
CGCTCGAGATGCCGCTCGCgtgacgatgcagcagcaagtcacAGGCTTTGACAAGCTgcgtcagcaacaacagatgAGGACCAAGAAACAGAGGCGTGAG
GAGGCTGCCGCTCTAGCTGCTGAGAGCACGGCGCACCTaaaggagctgctgaattTTGGTGTATTCTTGGTGTTCTCCTTCTTACGCAGGAGCGGGAGCG
TGAAAGACCAGGATTGTGACGAaaagaagagctcgagcgtATCGTTAGCTCCGGCTCAACTTATCGATCCACTGGTGCCTTTACTGATGCGTTGCACTGG
TGAAGCCAGATCTGACCGAGCGACCATCAACTCGCTGAAGTGCTTAGGCTCCCTGCTTCCccggcaacaacaactaccTGCCCTCCGCGTAGCACGCACA
CCGCTAGTGGATAGGCTTTTCAAGATCCTGCAGAAGGCTGGAGCTGCTACGCGCAATGAGATGGTGCAGACATGTTACCGCACGCTCACATCACTTctga
aacagcagcaagggCTGGAACTTGCGCAGCAAGGCACGCCCCAGGATTCGAAGAGTGAAGCACTACGTCTCACAGAATCGCAACTGCGCGTGCTTCTCAG
TTTTTTGCGCGCGGATCTGGACGAACAGGATCACCAGAACGCCACCTTTGCTTTGTTGAAGGCCATCGTGAACTCACGGCTTGTAATTAGCGAGGTGTAC
GACGTGATGATGCGTGTTGGCGAACTGCTCGTACAAAGCGATGGCCCTGGCGCCCGTGCGAACTGTGCAAGTATCTACCTGACCTTCGTGCTTGAGTACC
CTCTGGGAAACAAGCGGCTGTTGCGGCATCTCAAGTTTTTGGTCGACAACCTAAGCTACGATCACGCTACAGGACGCTCGGCTGTGCTTGAAGCTCTGCG
TGCTCTTCTTTCAAAGCTTCCGCAGGACTTGGTGAACACTCGTTCCCAGTTTTTCTTTTTGCCGCTTGTGCTGCGTTTGGCTAATGATGAAGCCGTTGAG
TGCCGTGACCTGTCTAAGACAGTTTTGACGACGTTGGTGCGCCGGCTCGGTAACAAGGAGTTGAACGAAAGTGTTCTGCTTTTAGGTAATTGGTGGGCAC
AAGCTACGAAGTcggatgcagcagatgcggTGAAGCTTCTGGGAACTGCAGCGCAAGTGACAACGCTTGTCCTTGAGACCCGCCCTGAATTCTTTGAGCG
CACTGCGCCGCAAGTACTGCAAGCAGCGCGTACGGCTCTCGAGCGCAGTTTGCGTGAGCTCCAGACTGTGGAAGAAAGCAACCAGGTGCAATGGCAGCCA
GTGTATCACGTCTGTACGGCGCTTACAGCTTTCAGTGATCATCTTACGGGACCCTTCGAGGTATGGCTAGAAAACTCAAAGTCGAAGAATGCATTCTTGG
ATGTCGtggtgctgccactgctgcagtaccCGCACGCATGGGTGCGACTTGCAGCGACCAAGTTGTTGACGTCGTACCTGCGCCGCCGCCGTGCCAACAC
GCTTGTCTTTGCTGCTCCTGTGAAGCGGCTGGCGGCGGACGCTGCCAAGCAATTGCGCAATGGCGCGCTGTACTTACAGCGCCCCGGTCGTCTGTTTGTA
TGGGCCAGTGCGATCTGCAAGCTGCTAGAGACACCATCACTAAATGATGAGCTAGCTAGCGAGATTCTTACGGCAATGCCGTTCCTGTGTGAGGCGATGG
AGGCCTTGCCTGATATTCCGCAGGACGTGACTGCTATAGCTGTTGATGCTATTACATCGGTAGACAAGGTGAAAACAGACGTTGGCGCTGAGGCAactga
ggaggaagaggccgCTACTAGCGAAGACAAGGAGGAAACCAACGAGGATGaggcagagctgcagcatcgcgaggaagaagaaaaggaggaagagcgtgCT
AAGGCACGCACACCAATTGGGTGGCTGCTTACACGTCTTTCGTATGTGGCGCGTGGCTCGAAGTGCAGCAACGAAGTGCAGGCAGTAGTGTTCAAGTTGT
TCGCTGCACTGCTGCACAATCACGACACTGCCTTCGCGCAGCAGTATGTGGTTCAATTTATCAACCCGCTGTATCGTGCCTCAAgcaagctggaagagct
gcaggccCAACAGGAACaaatgaagctgcaacaacagcagcggagTCGCCAAGGATACAAGAACCGGAGAAGTGGTCCTGCGCCTGAGCCCGTGGCACTG
CCTGAGAGTGCGCTGCTAGCTCAAGAAGTGCTGCAACTTCTGGAGAGTAAGCTCGGAGCCACGCCTTTCCTGGAGGCGTATTCATTTGTGCAGAGGAAGA
TGGCAGCTGCTAAGGCTGcgcgcaagctgcagcggcgcACCGAGGCTGTGTCCGACCCGCAGCGTGCCGCTCAGCGCCGGATGCAGAAGAACGAGCAAAA
GCGCCATACCAAGCAGATGCGCAAGCGCAAACACGCTGTACTCAAGGGCTCGACGTCGGCAGCAGTCCGCCCAACCAAGGTGCTTCGTCCTGGCGCCGAA
TAGAGTTTCATACGCAAGATACAGACCAGATAGAGATTATTCATGAACACGTGCATTTTCAACCTTTGATTCTGATGAATGCAATGATTGA