Description :
From Genome Similarity Track
Location :
Scaffold_78:50827- 58014
Transcript NameFunction/comments
Pytir_DAOMBR486fgenesh-pir_contig_78-abinit-gene-0.108Nardilysin
Pytir_DAOMBR486maker-pir_contig_78-fgenesh-gene-0.16Voltage-gated Ion Channel (VIC) Superfamily
Pytir_DAOMBR486maker-pir_contig_78-snap-gene-0.4240S ribosomal protein S15a

Sequence
7187 bases(100 bases per row)
GCAATGGCGGCGACCATGACGCACGCGTCGCTCAACGACTTTCGCTCGCCCGCGGACAAGAAGAACTACCGCGTCGTCACGCTGTCGAACGGTCTCGAGG
CGCTGCTGATCCATAACGAGGCGAGCGCTGCTAGCAGTGGTAACGAAGTAGAAGCCGAGCCGGAGCCGGAGCCAGTTGGCGCGGTTACCAACCCGAGAGC
CCGACGCTACAGCTTCTTCAGCACCAAGAACGACAACGGCGACGACGACAATGGCAATGACGATGACGACGGTGACGAAGACGGTGACGATACCCCAGTG
AGCACGCACCATGCGGCAGCGTGCATGACGGTCGGCGTCGGCAGTATGGCGGACCCGCAGGACCTCAAGGGCCTCGCGCACTATCTCGAGCACATGCTCT
TCATGGGCAGCGAGAAGTACCCAGACGAGAACGAGTTTGAGTCCTTCCTGAGCACCCATGGAGGATACAGCAACGGCGCGACCGAGTGCGAGTCGACACG
CTATCTCTTCGAGATCGGCCCCAAGCACCTCGAGCAGGCGCTCGACATGTTTGCGCAGTTCTTCATCTCCCCCTTATTTAAACAGAAAGCCATGGAGCGC
GAGCTCCTGGCTGTTGAGTCTGAGTTCAACCGCGCGCTACAAAACGACTATGTGCGCCTGCAACAGATCCAGTGCGAAACGTGCGCTCCAGGCCACGCGT
ACGACACGTTCAGCTGGGGCAATACCGAGAGTCTGCAGACGATCCCGAACGCGAAGGGTATCAACGTGCGCGACGCCATGATCGATTTCTACAAGCACCA
TTACTCGTCGAGCGTGATGAAGCTCTGTGTGTATGGTCAGGACTCGCTTGACGACATGGAGAAGTGGGTCCACGAGTCATTCGGCAAGATTTCCAACCAT
TTTGCTACCAGCCAAGCCGACAATTTCGAACCCAAAGTGTCTCCTCGACCGCCATTTGGCGTGGCTGCGGGTCAAGAATCGACGCTGATCAAGATTGTCC
CCATGCGCAAGATGCACGCGATGCACTTGTACTGGTCGCTGCCTCCTCTGCTCACGAGCTATAGACAGAAGCCCTGGGAGTACATCTCGCACGTGCTCGG
TCATGAAGGGGAAGGATCATTGACTGCGGTCTTGAAAAAGCGTCGCTGGGCGACCTACGTCTCTGCAGGTATCTCCGAGGGCGACAGCTACGAATTTGGT
TCGTTCGGGAGTCTCTTTGAAGTGGGCATCACGCTCACGCGCCAGGGGCTCGAGCACTGGGACGACGTCGTGCAGGTCATCTTTGACGTGATCTACTTCG
TGAGCGCGAACAAGCTCCAGCCGTGGATCTTTGACGAGCTCAAGGCGTCAAATGAAATGAGTTTCCTGTTCCAAGAAGAGCAGGAACCAATTTCCATCTG
TCGACGCATGAGCCACCTCATGCAGACGCGCCATGGAGTAGACAGACGCGACTTGCTGCGCTACGACACGTTGCAGGGCGAGTTCCAGGAAGCGCCGGCA
CGCGCGCTGTTGAACGAGATGACACCCGCAAACACCCGCGTGCTGCTGTTCTCCCACTCTTTCAAAGAGAACGAAGAAGCGGGGCTGGTATTCAAGATGG
AGAAGTGGTTTGGCGCCAAGTACGCAGCGTCGACGATTTCGTCCGAGGTTCTGAAGAAATGGGCGGCTCCATCGGGACAAGAAATGCTCAAGAACCCATC
GCCAAACCGGTTCATGCCGCAGAGCTTCAAGATTATCCCGCTAGAAGTCGACAATGTGGACTGCTGTGATGGTGATGCTGGTGATGACGACGCCCCTCGG
TTGGTGCACTCGACGCCGATGAGCAAGCTCTGGTTCAAGCAGGACAACAAGTTCTTTGTGCCAAAGACGAACGCGAATTTCTTGCTTTGTCTGCCCTCGA
TCACCAGGAGCGTCTCGAACTACGTTTGCACCAAGATCTACATGAATATCGTCAATGACGCGCTCAAGCAAGTGTTCTACCAGGCGAGCAACGCGAACCT
CGAGTTTGGAGTCGACATTCGGGACCTCGACATCGAGGTCACGTTCAGTGGCTTCAGCGACAAGCTGCGTGACCTCATCAACGTGGTTTTTCAAGTGCTC
GTGTCAGCAAACATCACGCCGGCGGCGTTCACCGTCATGCGCGACGAGCTCGTGCGCGAGTATCGGAATCTGAACCTCAAGCCGTCGATGAAGGCGCGGT
ATCTGCGTCTCCAGCTGCTTGAGCGCGCTGCGTTCTCGGTCGAAGACAAGATCCGCGTGCTCTCCGAGGTGCAGCTGGACGACATTGTGCGATTCCGAGA
CAACGTGATGTGGAGTAACACTGGCGATAGCAATGTGGCGCTGCGCTGCCTCGTGCACGGCAATATCACGCGTGCAAGTGCGATTGAGCTACTCTTGGAA
GTCGAGACAGCGCTCACACTTCATGAACAGCACAGTGTCTCTACTCTGCCGCCATCGCCACCAAAGTCTCCAATGCGGCCGCACACGACCGAGTTGCCGA
TCACTACGAACGGCATCTTGCTGCGAGATATGAGCGAGCACGAAGAAGAGACCAATTCGGCGGTCGAGGTGTACTACCAGATCGGCCGGTGCTCCTACGA
GGACCACGCGTATGCGGATCTGCTGCACCAGATCATGCAGGAGCCGCTGTTCCACCACCTGCGCACGAAGCAGCAGCTCGGCTACGAGGTCTACTGCTGT
GTGCGCGATACGCACGGCGTGCTGGGCTTCAGCATCACAGTGCAGTCGGCGTCCTACGCCTCGGGCGAGATCGCCGTGTGCATTGACAAGTTTGTGCACG
AAGGTTTCCTCCAGTACCTGAACGAGGAGCTCCTCGGCTCCGACCAGTTTGCGAACCACGTTGCCACTCTGCAGCGGCTCAAATCGCGACCAGATACGAA
TCTGGTGGACGAGACCGACCGGTACTGGGAGGAGATCCAGTGCCGACGTCTCGACTTCCACTTGGAGACTGAGCTGGTCAAGGCGCTAGACAAGTGCACA
CTGTCAGGGCTCATTGAGCGCTACCACACCTGGCTGCTGAGCTCCTCGCCAGAGAACGATGATGGTGGTGAAGGTACGGACACTCAGGAAATGAGTGGCT
GTGGTGGATCGAGGAAGCTGCGAGTACACATTGTGGGCAAGAGCAGCACCTTTGTGCCGCTGGAGAACTTGGTCTCGGAGGATGAAGCACCGCAGATCAT
TCGCAACCTACGCGAGTACAAGAAAGCGCTCACCTGCCACTGTTAGATTTGGTTTTATAAGATAAATGGATAGACAACTAGATTGACGCCTAGTCACCTC
CATATCCGTTCGTTGCTTAAATATTTGCGAGTGGATTACGAATTGTTATCTCATCACGAATCCCCCCATTTTGAATTGTTGGCCTCTCGTGTACTCTGAA
TCAATCTAAACTCTATGTGCTGGTATTATCCGCTTCGAAGTACCTTGTCGCTGATCCGCTAACTCTGAATTCTCGGCATCACCGACGACATGATTCACTC
AAAACTGTCGCCGCTCTAGAACTCCTCGAGGTCTTTCTGCGTGAGGAAGTTGCGTATCGACTGTCTGCGGCTGCGGCTGCGCTGCAGCGGCATGGACTGC
ATGCTACCACTGGCCATCCCGGACCCGGACGCTACGGTAGCTCCTGCTGATGCTGCGCCATTCGTCATCCCAAACGAGTCGCGCTTAAAGAGCCCCGACT
TGCTCGCTGACCGTATGATCTCGCGGAACGCGTTCTGCACCGTGAGCTTCTTCTCGATCTCGGCCACGCGATTCTCCACATCGTCGATGTGGTCGTTCAC
GCGAAGATTGGTGACCTCGACCTCGCTCGAGACGCGTCCGACCTGCGCGAGGATCGTCTGCAGCGTCGTCTCGAGTAGGATCACCCACTCGGGCATCTCC
TTGCTCTCGGAGCGCAGGTTCCGACTACTGTCGCGCGAGTACATCAGGTGTGTCGGGTGTGTCAGCTGCTGTTGTTGTCACTCGGGCGATACTGGTGAAG
TTGAAGATACGGAGGCTGTCGAGCCTGGTGCTGGTGCTACTGCTGTCAACTGGAGCGACGGTCCATTTGATGCGATACCTGGCCATTGACATTGCTCGTT
GATGATACTACCACCAAAGTGTTGATGTGTCGACTCGACCTGCCGCTGTGGTTCAGTCCTCCGCCTTCAGGGTATTCGAGAGGTATCGCATTTGGCTTTG
ATGGACCATTCTTGGCGAGCTCTTGCTGCTGCTGTTGCACCTGCTGCGTAACGACGCTTGACACTGTTGTGTTTGTATTTGCATTCATGGTAGGTGACGT
CTGCTGCTGCTGCTGTGGCAGGGTCGAATTGATCGCTAGCTGGAGGTTGCTCATCTTGCGCTTGCTCTGTTGCCGGTCCGTCTGGTTGTGGAAGAGCTCG
GACAGGTCCTCGATCTTGGTGCGAATGTACTCGACGTTCACCTCCATCATCTCGAGCATCGTCATCTGCTTGTCCATCGGGTCGCTCATGTCGTGCGAGT
TCACGTGGTGCTTGACCTGCCGGTACGCCTGCAGCACGGCGTAGAGCTTTATCTCGCTACGCCGGATCGCGTTGAGTCCGCGGTGGTGGCGCCGCTGGGT
GCCGATGAGCTGCACAAACGCCTGGATCGCGCGCGCTGCGTGATCATTGATGAGCCGCCGGTTGTCGTCTTTCTTCAGGAACGCGTTCACCCTGTGCTCG
GAGCGCGTGAGCACAAGCTGGTTACCCATGATGGCGATCGTCACGGCCGTGAACACAGTCCCGAAAGCGCCCGCGAGCACCGCGAAGAACCGGCCGGGCT
TGTGTGCAGTACCACGTTGTCGTATCCTATTGTGAGCACAGTCATGATGAGCGTCCACATGGCGTCGGTGAACGTCATGGGCTCGCAGCGCGAGTCCGTC
ACGAACGCGCACAGGAAGCGCTCGACCACGTAGAGCGAATACCCAGCGACGCAGAGCAGCAGGAACCGGCTCGGATGGTTCTTGAGCGTCGACTTGAGGA
AGGACGCGGCCGTGAAGTCAACGTTCGTGCGCGAGCTGATGAACCAGTCGTTGCTCGAGTTGAACGAGTTGCGCGACTGCATGGCGCGCAAGATGAGCCC
TACGCGGAAGAACATGAGCAAGCTCGTGGCGATCACCATGTTGGGTCAGCGCGAGTCGACTGACTCGAGTCCAGGGAACGGGTGGATGCAGAGTACGAGC
AGCTCCAGGGTCAGGTTCATGCGCAGCGAGGAGCTCAGCAACGTCGCCTGCGGGGGAATGATGTTCTTGATCTTCATTACCTCGCACTCGGCCACGTAGT
ACCAGTAGATGTAGTAGAGCAGGATCGCGGTGGAGAACGAGATGAGCACACACAGCGCGTGGAGGATCATGTGGACATCCTGGATCGGGATGTTGGCAGC
CGCGTTCAAGCTCGGCGCGTCTCGACAGTGTGGACACGCGTCTGCAGCGTGCATGGAACACGGGCTCGCGAGTTGCTTGGTGTTGGCGAACCAGAGGTAC
TCCATCTGCACGACCATGAGCGTGAGTTCGAACATGGCGTAGAAGAGCTGGAAGTTGGTGTGGCGCTTCTGCGACGTCACCAGCTGGTTGCGTCGCCTTT
GCGACGACATGGCCTCAACGTTCGTGAACATGCTCTTGAACGCCTTGGCCTTCTGCGGCATGGGTACGGCGCCGCGCAGCGGGCTCGAGCCGACGGCGCT
TGTCCCAGTCGGTGCGGCCACGCGCAGCGCGTCTATGGGTACGATCTCATTCCGCGCGACGGTCATGCTGGACGGAATGGCGGAGAGCGATTGATAGATG
GACGGACAGTAGACGCAGGACGACGACGACGACGCAGCAGCCTCGAGGTGTCAGTGGGTCGGACCGGATCGGGGGCATTCATCCACACAGAGCCAGCCGC
CTGCGTGGAGTTACAACTAACAACTGCACCGTCCGCGTCTGTCGGACTCAGCTAGCTGCTTGAAAGAGATGACGGCAATAGACCAGAGAGCGCGGCGTCA
CACACGCACACACACGCACACACGCACACGCACGCACGGCCACCGCCTACGCTAACTGCTTTGCGATGGTTGGGGCGTTTGCGTTGGTAAATAGCAGCAG
GGGACTCACTGCGGTGCCCCAGCGCCCCATCGAGATTTGGGGCGGCGCGCTTAATATGGGGCGAGTGACAGCGGTCAGTTTTCTTTCCAACTGACTGAAG
GTGTCGACTGAATGGCTTCCCCCAACACGTAGATACCGGTTTGAGATGAACGCCAAGCCATTGCGCTTTGTGGCATAATATCGTCATCATCACGCGCACC
ACGTCGGAGCAGATATTAGATACAGCACACAAGTACACGCAGGTCGAGAGTCAAAGGCATGCATGCATGCTTAAATGATTCAATGACAACAGACAAACGG
GAATGCGCTTGGTTGATAACCCAAAGATCACCTTCATTATTACAGATCTCGCGAGCGAGACGCGGTTGTTCTGTTACTGATCCCTAATGTTCTGTGCAGA
CATCATGAGTGGCTGGATACGATCGGATGCGTCTAGTAGAAGAAGCCGATGATCTTGCCACCCGTGTGCTTTCGGCGGGCCTCGTGGTGGTCCATGATGC
CGTACGTGGTGGACACGACGATGTGGCCGAACTGGCGCGATGGCAGCAGGTTGTTGATCCACTTCTCGTAGTCGTGGATCTTCACGTCGAAGCGTGGCGA
GATCACACCGCACTTGTTGATGCGGCCCTTGAGCTCGATCACGATCTTGCCGGCGCGGTGGTCGTCGATGATCTCGAACTCACCAATGTAGCCTGCGAAT
AGATACGAACGATACAGAGAGACAAGTCATCATCAGCACCTCGTCCCGACACCAACATTGCGATACAGAAAACGTGCGAGGCTTGCTGCAACGACGTACC
GTTCTTCTGCATGACCTGGAGGAACTTGACAATCACCTTCGACGAAGGGCGGACAAGCACCTGACGCTTTCCGCGCTTCTCGGCGTTGTAGATGGTCTTA
AGGCAATCGGCAAGCACGGACATACGCACCATTCTGGGAAAGCGGAAGGAAGCAGAGAGAGAGACACACACATAGAGGAACACCACGGATTAATCGACAC
TGAAGACAGCCAAGGACATGTTCACTCCACCGCGGTGCGACCCCCACTCTCCCTTGTAAGGGGGAAGAACGGAGGAAGCCCTGCGAG