Description :
From Genome Similarity Track
Location :
contig_86:50824- 57560
Transcript NameFunction/comments
g12873.t1hypothetical protein
g12874.t1XP_009521552.1 hypothetical protein PHYSODRAFT_484119 [Phytophthora sojae
g12875.t1hypothetical protein

Sequence
6736 bases(100 bases per row)
TGGATTGTCGTGCTCTTTTTTCATGTTTTCAATACGGGTTACTCGGTATCTCTCGCCTACGTTTATCACTACATGTCTTCCCCCGCAATGGACTACTACG
TCCAGCTGTTGCGAATGATGCCACAAGAAAACTATAATGGAATTATCGCTCTCTATGCCTGCATTGGGGCCGTGAACTTTTACAGTGCGCTGAAGATGTC
TCTCTACTCGCTGTACTATCGACGACTGGTCTTTCGTAAGATGGCGGATACGAATATCGACACAGAAGACGAGCAAGAGAATGAGGAAAAAGAAGAAAAT
GTAGGTGTTTCAACGAGATTCCGAGCATTAACACGTTTCGCGTCTGGATTTGCACGAGCCACCAGCGCTCGCGGCGAGTGGTTCGATACAGTTCTGCTCA
TGCGAGAGGTAGCCGAAATTTCATCTCAGACTGTGCAGGCTTACTCATCGAGCTATCTCATCAGCAGTGTCTGGATGAACCAGGTATTTGCAGGGTTGAT
CTTCTTGAACGCAATTGCTAACACGCTCGTGCACTACAACCTGGAGGGAAAAGTTGGTCTGAGGCGGTTGTACAGCACTGCGATTGATCTGTCACTAGAC
TTCGCGTGGGGTTTTATAATTCCAGGGAAGATCATATTCGTCTACATCTCGATGTTCATGGCAAACAACGGTTCGTTTCCAAACGAGTTCAATTACTCCG
ACACGCTCCAAATCAAAGCAATCTTGGAATGCAACCAGTTCTTCATGGTTACGTGGTTGGATGCGGTGACCACGACGTTGCCATACCTGAACATGCTTTC
GGGTCTGCGAAGCGTAAAATTCTTAATCAGCACGACATGGAGGTGGTTCGTTTTATTTCATCAACGAAAGTCCAGCCTATAGGGCCGACGGCACAACTTG
CAAAGCTGCAAGGGGCTGTCGTCGCCCCAGATCCAGCGCAAAAGGCTCCAGGATTGGCAAAAGTCGCGGACTCCGAAGAACACCAGGTCGAAATAAAGCG
CAGCGTCTGTGGAAGGCTAACAACAGGCGTCGTAGCACTAATGCCTCTCTGTGGACTGTTTGTCCTGCTCACATCTATCACTTCATCGGGGGTATTCTTT
AGCGGCGAACGCACATGTGCCGTGGGTTGCAAATTGCACATGCACCCGTGGTTCTCTACGAAGTGTTCATGTTCAGTCATGGAGATGAACTGCTTCGAGC
GGGGTATCACTGGTCGCGAAGCCGAAACTCGTAACATTCTGCAGTCGCTCGACCCCAAAGTGTTGAACTCTCTCATCATCTCGCACTGCCCTGAGCTTGT
TATCACCGAGGACATTCGCCGGTTCAGCAATCTCATGGCTCTCGAGCTGTACAACTCGACGGTTGTAGAGTGGTTGAGTGCCGCGTCCTTGTCACTTCCC
TACATTCCGTCCCTCACGACAATATTTGTCGTGCGATCTCGATTCCTAGGACGGCCTCCCAGAGGGTTTAACGACCGATTTGTCGCCGAGTGTCGTGGAC
GTCGAGTTCGTAGCGTCGGATCTCGGTGGGCCATTACCAGACGACCTCGACGAGAAGTGGACGTCCGTTATAATGCTGTACTTGGAGCACTGTGGACTGC
AGGAGTTCCCACCTGCCATCACCAGGATGAAGCTGACGGATCTGTCCCTGGTGGACAACAACATCTCGGTAGTCCCGGACAGGATAAGCGAGAGAGCCAT
GTACGTTATGCTGGACCGCAACCCACTAAGTCACATCCCCGACAGCTACGCGTCTCTGCGAGAGCTCTTCTACTTGTCGTTCCAGTACACCAACATCGCG
TCACTTCCGCAATGGCTGCAAGATCTGCGAGCGGAAGGCGCCGGCATCAACTTCCGAGCGCTAGGCACGCCCTACTGTCACGACCTTCCACTCAACAGCT
CCGAGGCAGTCTTCGCCGCCTGCAACTGGGACGACTACAGCCACGGCATATTCCCGTTACCCACGAGGGACCAAGCGCGTGCCATCCGCGACTAACGTTC
ATTGAAAAACGAATCATTGACGCAATCGACCATCATTCTCCCTAAAGTCAAGAAAATCTTCCCTGAAGTCAAAAGTCCGCCGTCGGCTCAGTCACCTCCA
CTTTGTATTGCCAATGTCGCTGCTCCACGGCCGCAGCATCTTCCTGCGCGGCGTGCGGCGCCTCGAGGCGGTGCAGCGTGCGCGTATCTCGCCTATCGCG
TCCTCGCTGCGGCTGAGTCGCCGTCCGTTTGTGCTGCCTGCGCTGGGCAGCGGCGTGTTGAGCTTCTCGACGTCGGCGCTGGACGAGCATGAGAAGACTA
AGAAGGAGAAGAAGCAGCTGAACGCGCTGAGCGGCATGGGGCTGGACCGCCCGCCTGACACTGGCAAGGAGATCCTCAGCTTCTTGATGGGCCATTTATG
GCCTAACGAGGACACCAAAGAGGCCAAGGAGATAAAGCAGAAGGTGCTTATCTCGGCGGGTCTCGTGGTGGCTTCCAAGGCGCTGACGATCCAAGTGCCG
TTCATCTTCAAGGATCTGGTGAACAGTATGGGAGAGGCCTCCAGCGTAATGGCAGGATCGCCTGAGATCGCGGTGCCCCTGGCCATGGTGCTCGGATACG
GCCTCGCTCGCTTCAGTGCCAGTGCGTCCTCGGAGCTGGCCAATGGCGTGTTCGCTACCGTGGCGCAGAAGACCATCCGCAAGGTTGCAGTACGCGTGTT
CAAGCACTTGCATGCGATGGACCTCAAGTTCCACTTGGACCGACAGACGGGAGCGCTGTCGCGCATCATTGACCGCGGCTCGCGATCCATTGATTTTGTG
CTGCGTGCGATGGCGTTCCGGGTGGTGCCGACGGTGCTGGAGATTGGACTGGTGAGCACCATCATGGCAACGAGTTTTGGGCTGCCGTATGCGGGTGTCA
CGCTTGGTACTCTCGCTGCGTACACGACGTTCACGGTACTGGTCACGCAGTGGCGTGACGAAATTCGCCGTGAGATGAACCGACTTGAAAATGAGGCTGG
CGCGAAGGTGATCGACTCACTGATGAATTACGAGACTGTCAAGTATTTCAACAACGAAGATCACGAGACTGCGCGGTACGATGAGTCGCTGAAGGGATAC
CAGAATGCGGCACTCAAGACGCAGACGTCTCTCGCAATGCTGAACGCCGGACAGAATGGTATCTTTAGTGTTGGACTCATTGCTATCATGTACATGGCGT
GCGAAGGCATCGCTGCCGGCACGCTCACCGTTGGCGACCTGGTGCTTGTGAATGGTTTGCTGTTCCAACTGTCCATCCCGCTCAACTTCATTGGTAGCAT
CTACCGTGAAGTGCGCCAGTCGGTGACTGACATGGAGTCGATGTTCAAGCTTGGTGCTGTTTCGCCCGTTATCACGAACCCGGACGAAAATCTGAGCCTA
CAGGGCAAGGGGCCCAAGTCGATTGAGTTCCGTGACGTGGACTTTGGATACCGCCCCGAACTTCCGATCCTGCGCAAGACGTCCTTCAAGGTAGACGCTG
GCAAGCGTGTTGCTATTGTCGGCACGAGTGGCTCTGGTAAGTCCACAGTGCTTCGGTTACTCTACCGCTTCTACGACCCACAGAACGGTACCATTCTTAT
CGATGGCAAGGACATTCGCCAGCTGAGCCTGGATGAGCTGCGCCAGGCCATCGCTATTGTCCCTCAGGACACTGTGCTGTTCAACGACACGATCTTCTAC
AACATCAACTACGGTCGTCTGGACGCCACGCCTGAGGAAGTGATGAACGCTGCCCGCGTTTCACAGATCCACCGCTCGATCGAGACGTTCTCGGACGGAT
ACAACACTCGCGTGGGTGAGCGCGGACTGAAGTTATCTGGCGGTGAGAAGCAGCGTGTGTCAATCGCGCGCGCGATGCTGAAGGACTCGCCGATCCTGCT
GTTTGACGAGGCTACCAGTGCCCTTGACTCGGAGACCGAGTCGGAGATCGTGCGTGAGTTCGCTTCCATCGGTGCGAACCGCACGTCGCTGATCATTGCT
CACCGTCTGTCGACCATCCAAGACGCGGACGAGATCATCGTGTTCAACAAGGGCCACGTGATCCAGCAGGGCTCGCATGAGGAGTTGCTGCGCGACGTGG
AGGGCAAGTACGCCGAGATGTGGGGTCGCCAGAACAACCACGTGCTGGTCTGCTTGGCGCCGGCGACGACGACGACGACGACGAGGCCAATACCCTGTAA
ATTGAACTCGACCACCTCAACTACAACGTTTTCTGTGGTTCACACAACTATGTCATTCTTCTATTTAGTGACAGTCTAGAGCCAAAATAGAATCGCAGCA
TCGCACACACCAGCTCCCTCCGCGATGGACGCGTTGCTCGTGGGCGAGGGCCGCCTGAGCAGCAGCTCCAGTTCCTACAGTTCCAGCGACGACGAGCCCT
TGAGTCTCAGCCTCAAGCGCCACGGCGTGATGGCGCCCCCTCCTCCGCCGGACTCGCCGCCGCCAGACATGATGCCGCCGCCGCCTCCGCCTGGACCGCC
TCCTCCCGTCGACACGAAGCGCAAGCCGTCGAGACCGCGGCGATCAAAGACCAACACTCCGACAGTCGAGAAACGGGCACGGAAGGTGACGCCCAAAACG
TTGGCCAGGAAGCCGAGAGCGCGACGTCAGGCGTCTCCCACGAAGCAGCAACAGGTTGAGACGCCCGTCGAGAGTGTGGAGGAGGAAGAGGAGGAGGAGA
TGGACGAGGAAGACTTGGACGCGTACTCGGACCAGTCTGACGTGTTCGAAGACGACGTCGAGGCCATTTTGTTCGCGGAAGAGGAGGAGGATCGTAGCAA
AGGCTACACGGACTGTCTGACAGAGACCCACTTGGACAGCGCAGAGTACCCGTACCCGGCGTACCTGGCCAAGCTGTCAGCACTGTTTACGGAGCAAAGC
GCTTTCGGGAAGAACCCCGAGGACTTTATTTATTGCAACAACCTGCTGGTGCGTTCCCGTGGATTGTAGTGATGGATCTGTATCGTAGTGACTGATGAGG
GCGTTTCGTGTTTGCAGGTTAGTCCGAGTCAACTCAAACTTATGGATGAACGGACCGCTGCACTAGAACGTGGGAAACTGGAACAAGTGCGAACAGCAAC
AGCGTTGAAGGCGAAGGAAGATGAAAAGAGGAGAAAGCAGGAGAGGTGAGAAGAGTGTGATTAAGCATGCGCAGAAGAGTTTAACCGTGTTGAAAGTAAC
GCTGACATTTTTTGTGCTATTACAGACTGGTCGAAGCGCTGGAACCGCCTGCAAAGAAAATTAAAATATCAGAAGCCACGCTGAAGGCATTGGAGTCCAA
ACAATTAGTATCTGGGAGCACGTCCAGACCGACGAGAAATCCAAGTCGAAAGAGGAGTCGAAAGAAACCTGCTGCACCAGCTGCAGCACTTCCTGCAGTC
GCGACAGGTCCGTTAAATCCTCCTAGTGACGCCTCAGCGGGTAATAGGCAGCAGGTGAAGTCACGGTCGAAGCCGGCAAAGGCTGGCAAGGCGAATGGGA
AGGCGAGTGATAAACCCGTGACTACCTCAGCTGCTAAAAAGAAGACGGCGACTGCCAGTAACCGGACGAAGAAAGCGACAGCCACAACTACCAAGGCAGC
AACCAAGGTTGTGGCCAATGGCACGTCGAAAGCGATCATTTCAAAAACAACCAAGAGTGCCCAAGCTAGCCAAAAGCCAGTGGTGCCTGCTAGTAGCGCA
AAGGCAACGAAAGTTGAAGTGGGAATCGAGAAGAACCGAGCTGGGGGGGAGGAAGATCCTGGCAACGAGAGCTCGTCTTCCTCATCCTCGTCTTCCTCTT
CGTCGTCTTCTTCTTCTTCGTCTTCTTCGTCAGTGTCGTCACGCTCGTCAGCGTCCAGCAGCTCATCTGACAATGACACTGGTCGTGACAACTAGACGCA
CAAAGCTGGTTGGGCTTAGCAGAACCGAAAAGTTTTCGCTTAATTTTTAATGCTACTACCGTACGCGGTTCTCACAACACATTGTGCTGATCTTTCTTCA
CCTCACCTCGCCTCACCTTCGTCAACTCTAGGCAGTGCTGCCTGCTTCTCTGCCCAGATATTTGCTGACTTTTGCCCCAGCTCGAACAGTCGATCCAGCA
CTTCAATCTGCGGTGGGAAAAGTGCAAAGCGAGCCAATTGCATAATCGTGAACGGGAAGTCCGAGTCGATGGACGGACTGATCTCGTAGTCCTCCCGACG
TAGTATGTGGGCGTGGAAGGCGCACACCTTGGTGTATCCCGGTACTTCCGGCACCAAAGTGAGGAGACCTCCGTCCACGTGGTACTCTCCTCGAAAGACC
GACGTGCCCCGCCTCGCCAAGTACCAAGGCACATAGCACGATGCAATGAGCGCGTCGCACAGATCCTCTGTCGAGTGGAAGTCGTCGGTGAGCACCAGCG
CTCTAGCCGGCCACATTTTCTCCGTGGCGATCGTGAGGCGCTGCGCCAGCGTCTCCACGGGCAGGTCGCCGAACTTGGTGTGGAAGATGGCGCGCAGTCG
CTCCTCGAGCTTCCAGACGGTGCCGTGGCTATGGCAGAGTCTGGCCATGGCCTTGGTTTCCTCGAGGATGTCGCGCGTACTGGCGTTGGCAGCCAGACTC
AAGGCCGCAATGGCGCCTCCTGAAGCTCCGGCGAACTTGGAACTGGACTGGATGTATCCGGCATCCTGGAGGCCCTGCGCCACACCCAAGTGGTACGGGA
TCAGGAACCCGCAGCCACTGAAGCTGAAGCTGTGCG