Description :
From Genome Similarity Track
Location :
contig_28:508227- 509960
Transcript NameFunction/comments
g5662.t1hypothetical protein

Sequence
1733 bases(100 bases per row)
GCTGAAGAGCCGGCTGATGCCGCTGCTAACGAAGCTCATGGATAGTGAATATGGCTGGACGTTCAATAATCCAGTCGATCCCGTGCAGTGGAATATCCCA
GATTACTTTGATATCATCAAGTGTCCAATGGACCTCGGTACAATCAAAAAGCGACTGGAAAGCGAGCACTACAACAGCGTTGAGGCGTTTGCAGGTGATG
TGCGTCTGGTCTTCGAGAACTGCATTGCCTACAATAGCAGCACGAACAAGTTCAACATCGCAGCGAAGCAGCTACTCGCCTCATTTAACAAGTCCTTGGC
GTCGCTCAAAACCAGCTGGAAAAACAACTTTTCAAGCGTTGCGAGCAACGCCGGGAGGAGATGTGTCAGTTGTGCGGTGGGGACTCGTTCAAGTTTGCTC
CATGCATGCTGTTCTGCAGCGGTCCGTGTGCTGGTCGGATTCGAAGACACACGCACTATTACAGTGATCCTCGGGGAGAGCATCATTGGTGTTCAAGTTG
CTACAAGCAGATGAAAGAAGGCCCGATCGACATGTCACTTCTTCCCCAACTATCGAGCGCTGCTACAGAAGTGGCACCTCCTCCTGGTGCTGGTGCTGCT
CTGTTCGACGGAGTGTTGAAGAAGTCGTCGCTGGTAAAGCGGAAAAACAGTGAGGTCGCCGAAGAGCCATGGGTAGAGTGCGACTCGTGCAAATTGTGGT
ACCACCAAATTTGCGCTCTGTTCAATGAACGCAACCACGCGATCTCGGGCGAACAAGAACCATTTGTGTGTCCCATCTGTGTGAAGAAGCAACGTGCTAC
TGGCGTCAAACCGTCATTAGACAATGGTCTTAAGGCTAAGCGGCTTCCGATCACCCGCATGGCGAAGTTGATTGAGACTCGCGTAATGGAGGCCATTGAA
AAGGCAGGCAAGGACGAGGCCGTGCGCATGGGTAGCATGGGCAATTCCGACAGTATCGGCTTTTCTAATGGTGTCAAGGAGTCTGCGTCTGACACACAGT
TTGGAATTACCATTCGCGAAGTACTCAGCATTGATAAACAAGTGCAAGTCAAACCCAGAATGGCTAAGCTACTAGCGGCGAAGTATGGGAAGACCAAAAA
GGCTGAAACCGGCGCCACGGCAACTCAGTCAAAGTCCTTAAAACGCCCACGATCGACAATGTCTGCTGCCGACAAAAAGGCTGCTGCATCTGCCTCAGCT
TCGTCAGCTTTGTCGCTGCAACTGACGTATCGCTCGCGATGCATTTGCGTCTTTCAAGAACTGGATGGTGTGGATGTGCTGATCTTCACACTGTACGTGC
AGGAGTATGGTGCAGACTCCCTATCGCCCAACGCTGGGCGTGTGTACGTGTCATATTTGGATTCGGTGAACTACTTCCAACCGAAGAAGCTGCGCACATT
GATGCATCAGCAGGTGATGCTGGGCTTTCTCGAGGATTGCAAGAATCGTGGCTTTCACACGTGCCACATTTGGTCTTGTCCACCACTGAAGGGCGACGAC
TACATTTTCTTCTGCAAGCCAGAAAACCAAAAGATTCCGAAGTCAGCGCGACTGCGCCAGTGGTACCAAAAGCTGTTGCAGCAAGCGAAGCATGACGGCC
TTGTAGCCAATATGTCCAACTTGTACGCTGAATACTATATGAAGAAGAAAGCAGCCCACGAGCTGCCCTACTTCGAGGGCGATTACTGGCCGCGGCTCGC
TGAGGATCTTATTAAGCAACTGGAAGAAAAAGA