Description :
From Genome Similarity Track
Location :
contig_86:50818- 57554
Transcript NameFunction/comments
g12345.t1hypothetical protein
g12346.t1XP_009521552.1 hypothetical protein PHYSODRAFT_484119 [Phytophthora sojae
g12347.t1hypothetical protein

Sequence
6736 bases(100 bases per row)
TGGATTGTCGTGCTCTTTTTTCATGTTTTCAATACGGGTTACTCGGTATCTCTCGCCTACGTTTATCACTACATGTCTTCCCCCGCAATGGACTACTACG
TCCAGCTGTTGCGAATGATGCCACAAGAAAACTATAATGGAATTATCGCTCTCTATGCCTGCATTGGGGCTGTGAACTTTTACAGTGCGCTGAAGATGTC
TCTCTACTCGCTGTACTATCGACGACTGGTCTTTCGTAAGATGGCGGATACGAATATCGACACAGAAGACGAGCAAGAGAATGAGGAAAAAGAAGAAAAT
GTAGGTGTTTCAACGAGATTCCGAGCATTAACACGTTTCGCGTCTGGATTTGCACGAGCCACCAGCGCTCGCGGCGAGTGGTTCGATACAGTTCTGCTCA
TGCGAGAGGTAGCCGAAATTTCATCTCAGACTGTGCAGGCTTACTCATCGAGCTATCTCATCAGCAGTGTCTGGATGAACCAGGTATTTGCAGGGTTGAT
CTTCTTGAACGCAATTGCTAACACGCTCGTGCACTACAACCTGGAGGGAAAAGTTGGTCTGAGGCGGTTGTACAGCACTGCGATTGATCTGTCACTAGAC
TTCGCGTGGGGTTTTATAATTCCAGGGAAGATCATATTCGTCTACATCTCGATGTTCATGGCAAACAACGGTTCGTTTCCAAACGAGTTCAATTACTCCG
ACACGCTCCAAATCAAAGCAATCTTGGAATGCAACCAGTTCTTCATGGTTACGTGGTTGGATGCGGTGACCACGACGTTGCCATACCTGAACATGCTTTC
GGGTCTGCGAAGCGTAAAATTCTTAATCAGCACGACATGGAGGTGGTTCGTTTTATTTCATCAACGAAAGTCCAGCCTATAGGGCCGACGGCACAACTTG
CAAAGCTGCAAGGGGCTGTCGTCGCCCCAGATCCAGCGCAAAAGGCTCCAGGATTGGCAAAAGTCGCGGACTCCGAAGAACACCAGGTCGAAATAAAGCG
CAGCGTCTGTGGAAGGCTAACAACAGGCGTCGTAGCACTAATGCCTCTCTGTGGACTGTTTGTCCTGCTCACATCTATCACTTCATCGGGGGTATTCTTT
AGCGGCGAACGCACATGTGCCGTGGGTTGCAAATTGCACATGCACCCGTGGTTCTCTACGAAGTGTTCATGTTCAGTCATGGAGATGAACTGCTTCGAGC
GGGGTATCACTGGTCGCGAAGCCGAAACTCGTGACATTCTGCAGTCGCTCGACCCCAAAGTGTTGAACTCTCTCATCATCTCGCACTGCCCTGAGCTTGT
TATCACCGAGGACATTCGCCGGTTCAGCAATCTCATGGCTCTCGAGCTGTACAACTCGACGGTTGTAGAGTGGTTGAGTGCCGCGTCCTTGTCACTTCCC
TACATTCCGTCCCTCACGACAATATTTGTCGTGCGATCTCGATTCCTAGGACGGCCTCCCAGAGGGTTTAACGACCGATTTGTCGCCGAGTGTCGTGGAC
GTCGAGTTCGTAGCGTCGGATCTCGGTGGGCCATTACCAGACGACCTCGACGAGAAATGGACGTCCGTTATAATGCTGTACTTGGAGCACTGTGGACTGC
AGGAGTTCCCACCTGCCATCACCAGGATGAAGCTGACGGATCTGTCCCTGGTGGACAACAACATCTCGGTAGTCCCGGACAGGATAAGCGAGAGAGCCAT
GTACGTTATGCTGGACCGCAACCCACTAAGTCACATCCCCGACAGCTACGCGTCTCTGCGAGAGCTCTTCTACTTGTCGTTCCAGTACACCAACATCGCG
TCACTTCCGCAATGGCTGCAAGATCTGCGAACGGAAGGCGCCGGCATCAACTTCCGAGCGCTAGGCACGCCCTACTGTCACGACCTTCCACTCAACAGCT
CCGAGGCAGTCTTCGCCGCCTGCAACTGGGACGACTACAGCCACGGCATATTCCCGTTACCCACGAGGGACCAAGCGCGTGCCATCCGCGACTAACGTTC
ATTGAAAAACGAATCATTGACGCAATCGACCATCATTCTCCCTAAAGTCAAGAAAATCTTCCCTGAAGTCAAAAGTCCGCCGTCGGCTCAGTCACCTCCA
CTTTGTATTGCCAATGTCGCTGCTCCACGGCCGCAGCATCTTCCTGCGCGGCGTGCGGCGCCTCGAGGTGGTGCAGCGTGCGCGTATCTCGCCTATCGCG
TCCTCGCTGCGGCTGAGTCGCCGTCCGTTTGTGCTGCCTGCGCTGGGCAGCGGCGTGTTGAGCTTCTCGACGTCGGCGCTGGACGAGCATGAGAAGACTA
AGAAGGAGAAGAAGCAGCTGAACGCGCTGAGCGGCATGGGGCTGGACCGCCCGCCTGACACTGGCAAGGAGATCCTCAGCTTCCTGATGGGCCATTTATG
GCCTAACGAGGACACCAAAGAGGCCAAGGAGATAAAGCAGAAGGTGCTTATCTCGGCGGGTCTCGTGGTGGCTTCCAAGGCGCTGACGATCCAAGTGCCG
TTCATCTTCAAGGATCTGGTGAACAGTATGGGAGAGGCCTCCAGCGTAATGGCAGGATCGCCTGAGATCGCGGTGCCCCTGGCCATGGTGCTCGGATACG
GCCTCGCTCGCTTCAGTGCCAGTGCGTCCTCGGAGCTGGCCAATGGCGTGTTCGCTACCGTGGCGCAGAAGACCATCCGCAAGGTTGCAGTACGCGTGTT
CAAGCACTTGCATGCGATGGACCTCAAGTTCCACTTGGACCGACAGACGGGAGCGCTGTCGCGCATCATTGACCGCGGCTCGCGATCCATTGATTTTGTG
CTGCGTGCGATGGCGTTCCGGGTGGTGCCGACGGTGCTGGAGATTGGACTGGTGAGCACCATCATGGCAACGAGTTTTGGGCTGCCGTATGCGGGTGTCA
CGCTTGGTACTCTCGCTGCGTACACGACGTTCACGGTACTGGTCACGCAGTGGCGTGACGAAATTCGCCGTGAGATGAACCGACTTGAAAATGAGGCTGG
CGCGAAGGTGATCGACTCACTGATGAATTACGAGACTGTCAAGTATTTCAACAACGAAGATCACGAGACTGCGCGGTACGATGAGTCGCTGAAGGGATAC
CAGAATGCGGCACTCAAGACGCAGACGTCTCTCGCAATGCTGAACGCCGGACAGAATGGTATCTTTAGTGTTGGACTCATTGCTATCATGTACATGGCGT
GCGAAGGCATCGCTGCCGGCACGCTCACCGTTGGCGACCTGGTGCTTGTGAATGGTTTGCTGTTCCAACTGTCCATCCCGCTCAACTTCATTGGTAGCAT
CTACCGTGAAGTGCGCCAGTCGGTGACTGACATGGAGTCGATGTTCAAGCTTGGTGCTGTTTCGCCCGTTATCACGAACCCGGACGAAAATCTGAGCCTA
CAGGGCAAGGGGCCCAAGTCGATTGAGTTCCGTGACGTGGACTTTGGATACCGCCCCGAACTTCCGATCCTGCGCAAGACGTCCTTCAAGGTAGACGCTG
GCAAGCGTGTTGCTATTGTCGGCACGAGTGGCTCTGGTAAGTCCACAGTGCTTCGGTTACTCTACCGCTTCTACGACCCACAGAACGGTACCATTCTTAT
CGATGGCAAGGACATTCGCCAGCTGAGCCTGGATGAGCTGCGCCAGGCCATCGCTATTGTCCCTCAGGACACTGTGCTGTTCAACGACACGATCTTCTAC
AACATCAACTACGGTCGTCTGGACGCCACGCCTGAGGAAGTGATGAACGCTGCCCGCGTTTCACAGATCCACCGCTCGATCGAGACGTTCTCGGACGGAT
ACAACACTCGCGTGGGTGAGCGCGGACTGAAGTTATCTGGCGGTGAGAAGCAGCGTGTGTCAATCGCGCGCGCGATGCTGAAGGACTCGCCGATCCTGCT
GTTTGACGAGGCTACCAGTGCCCTTGACTCGGAGACCGAGTCGGAGATCGTGCGTGAGTTCGCTTCCATCGGTGCGAACCGCACGTCGCTGATCATTGCT
CACCGTCTGTCGACCATCCAAGACGCGGACGAGATCATCGTGTTCAACAAGGGCCACGTGATCCAGCAGGGCTCGCATGAGGAGTTGCTGCGCGACGTGG
AGGGCAAGTACGCCGAGATGTGGGGTCGCCAGAACAACCACGTGCTGGTCTGCTTGGCGCCGGCGACGACGACGACGACGACGAGGCCAATACCCTGTAA
ATTGAACTCGACCACTTCAACTACAACGTTTTCTGTGGTTCACACAACTATGTCATTCTTCTATTTAGTGACAGTCTAGAGCCAAAATAGAATCGCAGCA
TCGCACACACCAGCTCCCTCCGCGATGGACGCGCTGCTCGTGGGCGAGGGCCGCCTGAGCAGCAGCTCCAGTTCCTACAGTTCCAGCGACGACGAGCCCT
TGAGTCTCAGCCTCAAGCGCCACGGCGTGATGGCGCCCCCTCCTCCGCCGGACTCGCCGCCGCCAGACATGATGCCGCCGCCGCCTCCGCCTGGACCGCC
TCCTCCCGTCGACACGAAGCGCAAGCCGTCGAGACCGCGGCGATCAAAGACCAACACTCCGACAGTCGAGAAACGGGCACGGAAGGTGACGCCCAAAACG
TTGGCGAGGAAGCCGAGAGTGCGACGTCAGGCGTCTCCCACGAAGCAGCAACAGGTTGAGACGCCCGTCGAGAGTGTGGAGGAGGAAGAGGAGGAGGAGA
TGGACGAGGAAGACTTGGACGCGTACTCGGACCAGTCTGACGTGTTCGAAGACGACGTCGAGGCCATTTTGTTCGCGGAAGAGGAGGAGGATCGTAGCAA
AGGCTACACGGACTGTCTGACAGAGACCCACTTGGACAGCGCAGAGTACCCGTACCCGGCGTACCTGGCCAAGCTGTCAGCACTGTTTACGGAGCAAAGC
GCTTTCGGGAAGAACCCCGAGGACTTTATTTATTGCAACAACCTGCTGGTGCGTTCCCGTGGATTGTAGTGATGGATCTGTATCGTAGTGACTGATGAGG
GCGTTTCGTGTTTGCAGGTTAGTCCGAGTCAACTCAAACTTATGGATGAACGGACCGCTGCACTAGAACGTGGGAAACTGGAACAAGTGCGAACAGCAAC
AGCGTTGAAGGCGAAGGAAGATGAAAAGAGGAGAAAGCAGGAGAGGTGAGAAGAGTGTGATTAAGCATGCGCAGAAGAGTTTAACCGTGTTGAAAGTAAC
ACTGACATTTTTTGTGCTATTACAGACTGGTCGAAGCGCTGGAACCGCCTGCAAAGAAAATTAAAATATCAGAAGCCACGCTGAAGGCATTGGAGTCCAA
ACAATTAGTATCTGGGAGCACGTCCAGACCGACGAGAAATCCAAGTCGAAAGAGGAGTCGAAAGAAACCTGCTGCACCAGCTGCAGCACTTCCTGCAGTC
GCGACAGGTCCGTTAAATCCTCCTAGTGACGCCTCAGCGGGTAATAGGCAGCAGGTGAAGTCACGGTCGAAGCCGGCAAAGGCTGGCAAGGCGAATGGGA
AGGCGAGTGATAAACCCGTGACTACCTCAGCTGCTAAAAAGAAGACGGCGACTGCCAGTAACCGGACGAAGAAAGCGACAGCCACAACTACCAAGGCAGC
AACCAAGGTTGTGGCCAATGGCACGTCGAAAGCGATCATTTCAAAAACAACCAAGAGTGCCCAAGCTAGCCAAAAGCCAGTGGTGCCTGCTAGTAGCGCA
AAGGCAACGAAAGTTGAAGTGGGAATCGAGAAGAACCGAGCTGGGGGGGAGGAAGATCCTGGCAACGAGAGCTCGTCTTCCTCATCCTCGTCTTCCTCTT
CGTCGTCTTCTTCTTCTTCGTCTTCTTCGTCAGTGTCGTCACGCTCGTCAGCGTCCAGCAGCTCATCTGACAATGACACTGGTCGTGACGACTAGACGCA
CAGAGCTGGTTGGGCTTAGCAGAACCGAAAAGTTTTCGCTTAATTTTTAATGCTACTACCGTACGCGGTTCTCACAACACATTCTGCTGATCTTTCTTCA
CCTCACCTCGCCTCACCTTCGTCAACTCTAGGCAGTGCTGCCTGCTTCTCTGCCCAGATATTTGCTGACTTTTGCCCCAGCTCGAACAGTCGATCCAGCA
CTTCAATCTGCGGTGGGAAAAGTGCAAAGCGAGCCAATTGCATAATCGTGAACGGGAAGTCCGAGTCGATGGACGGACTGATCTCGTAGTCCTCCCGACG
TAGTATGTGGGCGTGGAAGGCGCACACCTTGGTGTATCCCGGTACTTCCGGCACCAAAGTGAGGAGACCTCCGTCCACGTGGTACTCTCCTCGAAAGACC
GACGTGCCCCGCCTCGCCAAGTACCAAGGCACATAGCACGATGCAATGAGCGCGTCGCACAGATCCTCTGTCGAGTGGAAGTCGTCGGTGAGCACCAGCG
CTCTAGCCGGCCACATTTTCTCCGTGGCGATCGTGAGGCGCTGCGCCAGCGTCTCCACGGGCAGGTCGCCGAACTTGGTGTGGAAGATGGCGCGCAGTCG
CTCCTCGAGCTTCCAGACGGTGCCGTGGCTATGGCAGAGTCTGGCCATGGCCTTGGTTTCCTCGAGGATGTCGCGCGTACTGGCGTTGGCAGCCAGACTC
AAGGCCGCAATGGCGCCTCCTGAAGCTCCGGCGAACTTGGAACTGGACTGGATGTATCCGGCATCCTGGAGGCCCTGCGCCACACCCAAGTGGTACGGGA
TCAGGAACCCGCAGCCACTGAAGCTGAAGCTGTGCG