Description :
From Genome Similarity Track
Location :
Scaffold_1383:508- 4728
Sequence
4220 bases(100 bases per row)
CCAATGGTGGATCCGACGAAGACGGAAGATGAACAAGTCTGTTACCATGAAGGCGGGGATCTACTCGCCGAGGATCTCGGGGAAGGCCTGGCGGTAATCC
CGGAGGTACCACTGACCACAGAGGAGGTCACGATTGACGATATCCAAGTGGATCCAGGGGCAAACGAGCCCGCGGAAGTGGATCGGTTACGTCATAAAAT
CTGGGAGAGCCGACATCTGCTGATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAATCGATC
GCTCAGAGGGTGACGAAGGTGGCGCCTCAGTTCCGAGAAAAACTATCGGATCTGATTAAGGCCTGCTGCAAGCCAAGATCATCAGTTTCCCAACGTCCCC
GTGGGCATCCCCAGTGGAAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGGTTAACGGTCTGACTCGATTGATGGTG
TATCCGATGCCTCTAATCAATGAGCTGTTGGAAGATCTGGATAAAGTACTCTGGTACTGCTCTCTTGACATGGCCAGCGGTTTTTGGGTAGTTACTATGA
CGGATCGAGCTCGCGCGATATCCGCATTCATCACACCGTTTGGACTGTTCTAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCA
ACGTCTAATCGATAACGCTCTCTATGGATTCACCCGAATACCGGAGTCCGAAAAGGGTGGGTCTGGGGAAGGCCATACGGAAGTGGATCCATTCGAAGCG
GGGGAGCCAGGGGATCCTGGACCCCGTCTGTGTTAGGACGCAGATCTTATATCGACGACATTCTAATCCCGGCGGAATCGTGGGAATAGCTGTGCGAAAG
AGTGGTATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGAGTACTTAGGCCATCGA
GTTTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTATCTTCATTAGCCGATTTGTCCTTCCCACAGTCGTTACGGGTGATGCAATCCTTCTTGGGCA
GTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCCCTGTTTGCCGCGGTATTGTATGAATTGAGATCGGTAGATTTCGCTGCGATGACCACTCCAGC
TGTCCAGATGAAAATCCAACAAGCTCTGGCCCAGGAGATGCCGGATCCACGAAGGGATCCAAGTGGTAGGACGCCAGAAGAGGACCTGAAACAGGAGCTG
GATCCACCCCGGGACCAACAGAGAGAGGATCCAGGCTGGATAGAGACGACGGATCAGAATATGGAACAGGCAGAATCTCGGTGGATCCGAGCTCAACACG
CATTCGTGGAACTGAGGAACAGAATCGCGACCACGCCTATCCTCCGTCACTTCGATCCGGAACGTCAACCTACGGTAATAGTTTATGCCAGCGACTGGGC
AGTCTCAGCAGTTCTGGTTCAAGAACATGAGGGGATCTGCTATCCAGTCACATTCGTCAGCCGGACACTGAAGCCGAATGAACTAAACTACGGAGCGGTG
GAGAAAGAGATACTCGCGCTCCTGCGCGTGTTGGATCTGAATTACAACCTGCTAGTGGGAAGACCCATCCGGAACCTGACTCGACACTCCACGCTAGCCT
GGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTTAGGACAGTGGGCAGCTTTACTCTCGCCTTGGACGCTGGAGATTGTGAAGTGTTCGAAAGGGGAAG
ACGAAATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTCGAGCTAAGATAGATGAGGCGCTGACTAGGATCGCCCCTAAGAAAGAGCCCAAACGCCGGAT
CCAGATCCCGATCCCGACGGTACAGGCAGACGAGGATCTGTACGTCCTGAGTTTCGATGGATCCGCTCGTGTACGACGCGGAGGAGGAGCATACAGTGCA
ATACTGTGGAGACTGCCCGGATGGGAAGTTGTACGAGACAGATCCACTTACGCAGAAGGCCTCACCGTCAATGAGGCGGAGTATAACGGACTCCTTCTGG
GTTTGGATTAACTAAAGGGACAAGATCCAAAAAGGCTGGTGATTTGTGGGGATTCCAATTTGGTAATCAGACAGGTGCGAGGCGAGATTGACTGCAAGGC
CCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGTGGATGGTTGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCA
GACAGCTTGGCCAGTGCCGCTTTACTGAATCAATGTGGTGTCGAAGTGGAGAGAGAAGCCGGGCATCAGGATCTCGTTACATTGAACCGACGAGACGAAG
TGGTGGTAGTTGGATCCAGGAAAAGAACGGTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGATTGGATCCAGCCCCCAGATCCTCGAGGAAACATT
TGTGAAGGGAGTCCGTATTGAGCGGATCCTCAAAGCACAAAACGAGGAAGCGTGGATCTTGGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTG
AGTCGGGAGGATACTAAATCCTACAGTATTATCGCTACGGATTACGCAGTGGATCTGAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCAACG
AGGATCGGGATGGATTGATGAGACTGGTGATGCCAGAAACCTTGCAACAGGATGTCCTACACCACTACCATGCTAGCCTGGAAGGCGGACATCAGGGTAT
TGGTCGGACCTACCAACGGATCCGGGAATGTTTCCACTGGAGAGGACTATTCAAGAGCGTACAACGATATGTCGGTGAATGCGTGGATTGTGAGACAGGC
AAGGGCAGGCCCACAATCGAAGGGGAGTCACCTGGGAATATCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCATATCCCCTCGTTGCCCAGCT
CGCTCAAAGGAAACACAGAATTGTTGATTTGGGTGGATTTGTTTACCGGATACGTGATAGCCAAAGCTAGTGCGTCTAGAACTGCGCAAGCCATTGCTGA
ATCGTACGAGGAGTGCGTTTTCCGAAGATTTGGAGCTAGCGAGATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTTGAGCATTCAAC
CGGATCCTGGGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGATCGGCCGAGCGCATGGTGCAGACAATCACGAGAGCACTCAAGA
TGTATGTCCAGGATTTGGATCAGAAGGATTGGGATGAGTACGCAGAGCGGCTTCCCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGATACCCC
ATGTTACTTGGTACATGGGTGGGATCCCAAATCCACCCTGGAAGCGGCCATCCCAGTTTGCAGCACCAAGAAGAGGAACCGAGATCCAAGGCGATGGCGA
TACCAAGTCCAGAAATACCACCGGCAAGCTAGATCCCAGGTGAACGAACGACTGCGGAGTGCGATACAGGGTCGAGCGGATCGACACAACGAAGATGCCC
GTCCACATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTATTTGGATCGAGTGAAAGAGGGGTATGCCCCGCAAATTGGCCCATCTATAGCATGGACCGC
TCCGGGTGAGCGAGAAGATTGGAGAACACGCGGTAAAGCTGAAAACGGCAGGTACCGAATATCGCCTGTTCCCTGTAGTACACGTATCCAAGCTGAAGTT
GGTCAAAGAATATCCGGATCGTCCGCAGATCCGTCTTTCGGTGGATGAATCCGACAGGGTGGATTTCGACGAAGTCCTCCTACCGGAAGATAGTCAGAAT
GTAAATCTCGAAGCCGACGAGTTCGAAGTCGAGAAGATCGCCGACATGAGGTCAGGGAAGCGAACTAGATACGGACGGATTTACTGTGAATTTCTAGTGT
ATTTGCGTGGATATGACGAACCCAGTTGGATAGACGAGGCAGATCTGAACTGTGGAGCATTACTCTATGATTTCTTGCGGGATCATACGAATCGTAACAG
ATTCGGCGTGATGCCGTCTCATGAAGAAGAGTAGGAAGGGGATCCATTGATGTGAGTTGGTCATATCGATGGGAGGATGAAGAAGGACCCACAGGAAGGG
TGTGGGTCAGGAGGAGGAGG