Description :
From Genome Similarity Track
Location :
Scaffold_1223:508- 2423
Transcript NameFunction/comments
Phyke_g11674hypothetical protein PHYSODRAFT_323073

Sequence
1915 bases(100 bases per row)
GCGATTGGTGCTTTCAAGAGGGTGTTAGCATGAAATTCGTCCAGGCTAGTGTTGTCATGGACACTTCTGGTAAACGCCTAGCGGCTATGATGGATTGCTT
CGGCTACTATCCCGCTACCAATGAAGGTAAGAAAGGTAAGCTTGCTCGTAATACTGCGTCATCATATTATAGAAACGTTAAGCTTTGGCTGTTCGACGAG
TATCCATACCTGCGTGTTGCTACTGAGTTGGTATTGTTAAAGCAAAGAAAGACATTAGATAAACACTGTTtaaaacgtgaaaatggAGGTTTGACTAATA
AAGCCCCTCCTTGTACTAAAGAGGATTTACGATCTCTTATACGCTACGTgtacagcacagcacgagTCAATTCTGACTACCAAGACGCTGCGCTGGCGTG
CCTTATGTGACATTGCTTCGGTTGGTCCTCGGATCTTGGCTACATCCAAAAGCAGCATGTGTCAGTATCCGCAGACGGTGTCTTCTACCTGCGGGTGAAA
ACAGCAGAGGAACAGGGACTTACCCTCATACCTGACAAGGCGGACTTCCTCACGTGCCCACTGCACTCGTTGGCGGTGGCACTGACGATGCAGGAGGCTC
CGTGCGTGTCGCTCCTCAGCCAGCTTCCGGAGCTTGTGACACCGGAAGCGGCCCCGCTTGACCCTGGAGTCCCGCTTCAGGACTTGCTGGCTGCCGAACC
AGAAGCGCTTCACGTTGCCTTGGTGATACCGGGGCACGACCGGTGCCGTCAAatgtggctgcagctgctactCAGTCGCCATCCCCGCCGGTACCTACAA
AATCAAGAACACAGGTaagcagcacagcaaccaGAAGAAGTCACCGGCTGGGCACGCGACACGAGGCGAAGATGGCGTACAGGTGTACGTGAACCGGATG
CTCAAGCGCGTCGCAGAGCCTGCAGGAGCGACGACAGACTTGACTTCGCACTCCTTTCGGCGCGGCGGTGCCCAGCACGCAAGCGGAGACGACCGTCTCG
CTGCTCAGTGGATCTTCGACCGCGGCGCATGGGACATGAGCAAGACCAACAAAGATTTTGCGTACGTCTTCAACACGCCATGGGGAGACCGCAGGGTAGC
TCGAGTGCTGAGCGGCTGGGAAGCCGACGCATCTCTGCCCgttgtcgacgttgctgtgctggacCATGCTACGCGGGAGCGACTGGAACGCTTGCAAGGA
CTCCTCTTCAGTTCCTGTACAGGGCTGAAAGAACAAAGACTCAATGTGAGTAGCAAAGTCCTCAGTGTACTCACCGCGTACCTTGTCAGATACTACCCGC
AGCTCAAGGCGTTTGGACCCACTGCCCCGATCGTCAAGCGCATGGAGGAGtgcttggctgctgcgtgcATTCCGACGGCTGACTTGCTTGCGTGGTCAGT
GGCTCTGGACAACGATGCCGCTTCACCTGCTGAGGAACAGACACGACATCAAGAGAACGCACACGCATGTCAAGGGTGTCACCTTTCAGCTGTCATTAAA
GAGCTTATCGCCACAAACAGAAGCCTAGCTGCACGCCTGACCATCGTCGAGGCTGCACTACTCAAATCTAAAGGGACCACGATAAgcactgaagaggaac
aagTACAAGATAAGTCAGATCAAGAACCACAGTCCAAGCGCAGAAAGAAACCAACCACAAACCTGTCTGTCGTGTGGTACGAGTGGTACACGCGAGTGCC
GAGTGTCTAGGACTCAGCTGACCGCCAGAAGAAGTCAGAATCCCGCcacgtcgtcgccttcacgaagctcttcctcgatGGAGGCTTCATCCTGGACGCA
AAGGCGGAGGACTACAAGGATCAAGTCCTCGACACCGGTCACCGCGCTGAAGCCAACGTCCTCGCATTCCTGAAAGCCCGGGGCGTCAACGCGAAGGGAG
CTGGAAGCGTTTTGC