Description :
From Genome Similarity Track
Location :
Scaffold_520:5079- 10185
Transcript NameFunction/comments
Hyaar_Emoy2814273hypothetical protein
Hyaar_Emoy2814274hypothetical protein

Sequence
5106 bases(100 bases per row)
CAAGCGCGACCGTTTGGCCTCCGAGAGGGGAGTGGGGTTATCCATCCTCACAGAGGATCAGTCTTTAAAGACTCAAGCGTAGATTGACTACTAGTGCTAC
CAAGTGTAGCGGAGCTGCACAGCTCCTTTAGTCGGAGGAAGACTTTAGTGCTCAAAAAGCGATACTGGTTCTAAAGAACTAGACTCTATGAGTCAACAAG
CGTAACGCTTAAGGTTCCTGTTCCAGGGAACCGAAGGATTCAGTGAATCTACAGTACTTCGTGCTCAAGAGTAGCTATCTCAGGGAGATGTTGCTAACTC
TTAACGATCAACGATCAGAGACGCCTCGCAAGGCACGTGTCTTCGACAAGATCATAAGGGGAACTGAACTTTATTTACGTTTAACTCTATCGAATATCTT
AATCCTAATATCACCTAATCTAGGCACTCATGTCCTAAATCAAGAACTTTCGAGATCTTTCTTGGCTGACACCAGTCGGCCCCTATAAGTCGATAAGATA
TTCTATATCTCTTTCAGTCGGATAACATCCCGTGCGTCTAAGACACAGGGTACCGAGTACCCTTCGATGTGTAACCCCGTTACAAATCCTTTCACATCTC
ACACGTTTCCTCATCAACGACGTCCGGCAATGGACATACACATATTAGCCGGCGCGACAAATTGCCGCAGTGGACTGTGCCATGTTCGATAGAACGAGTG
CCCCTAGCAACTCGCATGGTAGTTCGTACAACCCTGACCGGCCACTGTAATCCGCAGCTGTCGACCACCCCGATTTTTGATCTTCACCTGGCATAAAAGG
CAGCGTAGCACATTCGGCCATTCGAGATCTCCCGAAGTACCTTGATGTACCTCACCATACAATACAAAACAAACACAAGTCAAAAATAGACAAAAACAAA
ACATAGAAGCATGTGCTCGCACGGTCTGTTTGCTACCGTTGCAAACGTTTGTGTCTCTACAAACTACTGACACCGCGCATCTGTTGTCAGACGCCATGAT
GACCACCCTCCCAAATGTGTAACAATCAGCTTCTGACAAACAGCTTGGCTGATGGTTGCCGAAATACAGCACTCTACCTCGCTTGGTGCTTCACCACGTG
GTGAATGGAGCACGTCGAATGAGCGTTGCTGAAATGAATATCGCTCTTTGTCAGGACTCTGTATGGGCTACAGCTCGGACAAGTTGGCTAAAAATGCATC
ATAAGAATGCTAGTCACGCTACTTATGCTGACAGCCGTTGCCTCTCCCTCCGATTCATCTGATGACCATCTCCGTCCGATCCGCCTGATGACCATCTCCC
TGTGCTTTATCCTGTATTCTGGTAGTCACCGCAACGATTGTGCTTCGATCGAACGCAACCTCCGTCTCTATCTCGACGATCCTCATCAAGAGTCTAGCCT
TCAACCGTTACTACGCTCTATTCGTCACGAGAGAGGGTCGACATATAAACGTGGTCGGGTACACTCACAGCGCTCAGACCCTCACATGTGACTTCATTCT
CCAACTTCGGTCGCACAACCTACCCAACCAACCCAACACAGACACCTCCACAACCAAGATGAAACTCAGCAACATGATCGGTGCGCTAGGCGTGGCTGCT
TTGGCATTCTCGAGCAACACTGTGGATGCGTCGACGGCAGCTACGCAGACATCGGGACACCTGCGTCATCAGCACCACCGACACGGTCACAACCACCGAT
CCGGATACGATAACGACGACGACGGCGACAGCTCCGACTACGGAAGGAGAGGTTATAGCAATCAACGTGGCCGCAGGAACGACGACGTCGACAGTCGCGG
TGACTATAACTCGGGCGGCAACCGCAACCAGCGTGGCTATGGAGGTGCAGCAGCGGAGTCGAACAATTACGGTTCACCCGCTAATAGCGGTGCGACTGCC
AGTGCTGGTGCCAACGTCAGTAATGGTGTACCTGGTTTACCTGCTACTGCGGCAGCCACTGCAGGCAATCCCTCGAACGCAGGGCCTGGTGTAAACCAAG
GAGCTAAGGCGAATGCGAATGCGAAAGCAAGCAACGACGCTGCCAACGGGTACAGTACCGGCGGAGCTGTTCCGAAAGACATGTATGCCCAATAGACTCT
GCAGACGACCGTGCAGACCCATGGCGTCCGCCGCTTGCTCGTGTGAACCTTCATGCTTATTGTCTGAGAAGTAATAATCGCACGCTCGTGGTCTGAGCTG
TACCATGGACAGCTCACGAGACGCTTGAAACAGCCGAGATCACCTTAGCACCCTCCAACTTAAATACCGCCCCAAGCTTGACAAGCGTGGCGTGCTTTCC
ATTGGAGTACCGTCGTAGTTATACATGTAGTTTTGATGAGTGTAAATGGATGTCAGTGAATACAAACGCGATATGATCATTTCTGACTTGTTTTGTTCGT
GTTATCATCGCGTCGGTAGCCGTGTGCAAGGTCTCATTATCTGCTCTCTCCGTCGCTTAAATAAGTGTGCGCATGTGTAGGGGCGTACGAACGCAAAGCA
GAATCCACACTTGTTAGCACATTGGAAACGGGTAGAAAGAGACGTAAGGCTGGTTTAATTGCGCGAGGACTTACAGCGCCAGTTGTTGTTATGCGAGGTG
ATATCTTGTGCGGTGGTGGTTGTGTCGTCACTCGGCCTCCAAGCAACACAGCAACACAGCGACATGCAGCGGTCTTGAGCTCGTCCAACGCGTCAAACGT
TTCGGTGCTGTGTCGATGTGCAAGTACATAGTAGAGCTCACAACACGATGAAAGTACTCGAACATGACGCTTTAATGAGCCACATCAGACCTTTTTGCAC
CGCCGCATTCGTGTGTTGCGAGCCGTGCTCGGTTCGTATTGTTGCTGAAGTCGTGGAGAAGCAAGTTGGAAGCCACGCAAGCTCAGTCCTCCACATGTAC
TAGAATGAGACGCCCATGCTCGACGGCAGGCCCATTCATGCTGTCAACTTCGATGGCTTCGATAATTTCAGACCAAACTGAGTACTTGGCAAGCTATATG
GATTAGTCATTTTACTTTCGTGACCTACCCAGATGCAATGCACTGTGAAATGAGCTAGTACACATACTATATTCCACCACTCGGTCGCTCTGTGTCCACG
CTCATGCGCGATGTTGTCTTTACCGTTATCTTGCAAAGAACATAAGACGCGTGTAGTGGAGCTACATAGCTCTTTTAGTCGGAGGAAGACTTTAGTGCTC
AAAAAGCGATACTAGTTCTAAAGAACTAGACTCTATGATTCAACAAGCGTAACGCTTAAGGTTCCTGTTCTAGGGGACCAAACGATTCAGTGAATCTACA
GTACTTCGTGCTCAAGAGTAGCTATCTCAGGGAGATGTTGCTAACTCTTAACGATCAACGATCAGAGACGCCTCGCAAGGCACGTGTCTTCGACAAGATC
ATAAGGGGAACTGAACTTTATTTACGTTTAACTCTATCGAATATCTTAATCCTAATATCACCTAATCTAGGCACTCATGTCCTAAATCAAGAACTTTCGA
GATCTTTCTTGGCTGACACCAGTCGGCCCCTATAAGTCGATAAGATATTCTATATCTCTTTCAGTCGGATAACATCCCGTGCGTCTAAGACACAGGGTAC
CGAGTACCCTTCGATGTGTAACCCCGTTATACCCTCCCCCACCAGACTGCCGTTTACCGTAACGGCAATCGAAATTTGTTCCTCAACGAGATCAGTGCGC
TTGCGGTTAACCTCACGGTAAAGCAAAGATTTAGCACCATGTCCTCATCGCCTAACGAGTCAAAGGCTCTTCGCGCATATCTCGGGATTGAGGAGGCAGT
GGACTATGGTAGCGATATCAGTCTCGCGGGTGATGCAAGGACAATGTCCGATACACCCATGTCTGAGGTACAACTTCCGACTACGTTAAGTACGTTCTCT
GAACGTGATGATGCGTCTGCGCCATTGGCGCCGCATTCAAAACCTGGTTCGGATGATGCAATCATCACCAACCCGCTCGATGAGCAGCAACAGTTGACTG
TTCAACGAGAAGAAAGCGCTCGGCACCATGCACAAATGGTCACGACCCTTAAGAACCAGCGTGACTATGTGTTCACTCCACTTAGTGTGGAGTAACGGCT
ACGTCAAACGATTGGCCAAACGTTGGCAACGTGGACCATTGGTCCTGGAGCTACTTTTCCCGAGGAAGTGGCCAGGCACTTCGTGAGAGGTACCTGGAGC
CATCTCTGACAACGCAAAGTCAGTACAAGGCACGCCTTGAGATGCAAGAATGTGATACACCGGTTCCACCGATTAAGGGCGTACCCATTCTCTTGTCCGC
AGGCGAAACAACGGACGAAGAAGACGACGCCTTCGCTCGCTGGGTGCACCGCACTCGTCGTCTGAGCAGTATGTACGCTCTGAGAGCTAGTGCCAATGTG
GCTGATGTGCGTCTCGAACGCAAGCTTCGGTATGATTATGCCAAGCTTAAAGCCAGATGCCAATTGCGCAATCGCACGCGCTATGCTTCGGCTACTACGG
TAGCCGCGAGTGCTGGTCAGACTGTGACCAACAACCCGCCAACCCACACCACTAGTGGTGCGAAACGGCCTCGGTCTCGAGATGACCTTGGCCACGATGT
TCAAAAACATCCACGGCGTATGGTCAGTCTTGCCGAAGGGGAATCTCATATTCCCATGAGTTTTCCGACTATGGGTACCTTCGCCATTTTACCAAATATT
GGTATTGGCCATGACGACGACGTCGTTTCAGGAGTCTCTCCACATGAAACTGGCGGTTCCCTTGCTCATCGAGCAGCGTCGGTGAGGTCGGTGTACCGAA
GAAGAAGCATGAGAAGGTACTTCTTGAGCTGAATGGTCTCCGTGACACATTGGGTAAGACCTAGAGTGCGCTCGACGCGACGCAAGCTCGCGTTCAGGCG
TTGGAGTCGGGTCACACCCGGATGGAGGCCCAGCTTGGCCTTCTGATTCAGATGCAGCAACCGATGGCAAGGCCAACTTCCGCGGCGCAAGCGCCTCCAA
GTTCACGTGGTACGGATCCCGATATGGCCTAAGTAAGCCTACGTAGAACACCGGATGTGTGCGCAATTTGCGCGGGAGGTTTAGCGTATACGCAATTCCC
TTCTTG