Description :
From Genome Similarity Track
Location :
Scaffold_181:5079- 32350
Transcript NameFunction/comments
Phyag_g3159hypothetical protein PHYSODRAFT_248465
Phyag_g3160hypothetical protein PHYSODRAFT_353502
Phyag_g3161hypothetical protein
Phyag_g3162Mitochondrial/chloroplast ribosomal protein L13
Phyag_g3163hypothetical protein PHYSODRAFT_293850
Phyag_g3164hypothetical protein PHYSODRAFT_248380
Phyag_g3165glycoside hydrolase, putative

Sequence
27271 bases(100 bases per row)
ACAATCAGCTCGTTCAGATGTTCGTCCTGGTCCCGCCGGATGCAAAACACGCTCGAAGTTGTTTCCGAAGTGTTGGTGGTCCATCTGTGCTGCTCTGTTG
CCATCTTTGCAGTCGCGCATGTGGATGGGGCGCTTCAACCAAGCGGAGACTGAAGCGAGCGACTGTCTACgggagcagcaacgtcggACTTGCTCGACTG
CAACCTGTAACCTTCGCGAAGAGCCTCGCATCTTGACGCAAGACTTTCTCCTCGTGTTATGGGTGAACGGTGCGATCCTCATTGATGAGTCCGTGCAGCG
AAACAAGGCGTCCGCCTTGCAAAGACCCGAAGAATCTCCATCGAGCTCGATGCATGAATTTTCGCAGCCAGATGCACACGAAGCTTCTGCCCGCTGGCCA
ACAAAGCCAAGGCgatttcgctgctgccgcctgcGTTTTTCGACGGTGCCGGCAGTTAAACCGGGCACTTCACCTCATGGTCCTGCAAAAGACGGTCAAT
TTGCATCGGCCATGGACAGCAGATCGTGATGCGTCCTTCCTCTCCAGCAACGGTCTACCACCCTCGATCATCCCTCGATCCATTCTCGGATTCGCGGCTT
CCCTTGAGCAACAGAGTTGCCCAGCAGTTGAGACGACACTCAGTATCCCTTCCCTTTGACTGACGACAAGCGATGGCGACACAAACTGgtgtgaaggagg
aggccccgctccagatgaagacggtgaTCGAGCCGCAGTGGATTCGCTTCCTCGCCGGTGGCGCGGCGTCAGCCACCGCTGAATTGCTGACACTGCCCAT
CGACATCACCAAGGTGCGTCTCCAGGCGCAGCGTTCCGGCCCCACGGCGAGCGGCAAACCAGCTGTGCACTACAATGGCATGCTCCACGCTGTACAGACC
ATGATCAAGCAGGAGGGGCCTGGTGCGCTCTGGAACGGAGCCACACCTGCACTGCTACGCCAAGTCTCGTACACGAGCATCTGCATGGTGCTCTACGAAC
CGCTGCGTAACATCTTCGGTGCCAACGCAGCCAACGGTGAAGTCCCTTTCATCAACAAGTTCCTGGCCGGCGGCTGCGCTGGCGCAATCGGTATCAGCAT
CGCCAACCCGTACGCTTTCATCGGACGTAGTACATATCCCAACCCAGCAGTGATTGACTTATGCTCTTGTGTACGACAGGGTGGACGTCATCAAGGTGCG
CATGCAGGCGGACCGCTCCGGCAAGTTGTATCGTGGTGTCGGGGACGCCTTCAGCAGTATCTACCAGCGGGAAGGTGTCCGCGGGTTCCTTCGTGGCATG
CCGCCGAACATTCAGCGTGGCTTCATTGTGAACGCTGCTGAGCTGGGCACGTATGATCACAGCAAGGAGCTGTTGATCTCGTCTggactgctggaagaag
gtgTCTTCGCACATACCGGTGCCAGTTGTGTGGCTGGATTCGCCGGTGCGGCAACTTCGAACCCGTACGTACACTGCATGAGCATTAGGTGTCGGCTGGG
ATTGTTGGTTGCTGATGGTTGTTATGTTCAGGATCGACGTGGTGAAAACGCGTCTTATGAGTCAGCCGACCGATGGACATGGCAAGGGGCTCCACTACAA
GGGCATGTTGGACTGCATGCGGAAGACGTTCCAGGAAGGAGGCGCGCTCGCCTTCTACAAGGGATTTATCCCGAACTGGATGCGGAAAGCGCCCTGGTGc
gtggtcttcttcgtcacgTACGAGAAGTACCGCGCCGTGCTCGCGCCGAGCGACGAGGAACTGTAGACTCTTGTAAGACTGCCAGCAAGCGCTGCTGGGT
CGAGCAAGGGAAATCGTTTACCGTGAGTAGCATGAGTAGCAGGCCTTTAATGCTGATGAAGCTTGCAACATGATACAAAACGAATGCTTTTCAATTATTG
CTGCAGAATTCATCTCCGCTGCCCCCGCCGCCTTCGCACATGATAAATAAGAATACATTATCCTTTCTAATGAAGGCACCAGCGCGTCTCTCGCGGGGGC
CAGGGTAGAGATGGCGTCCAGTCCAGGAAGCTTCCCCTTCGCTTCCTTCCGTCTGCTTGCAGGAACATGGCGTCAGCCACCACAACACTCCGTGGTGTGG
TTCTCTCCCTTTCATTCATCTGGGCCTTGGTTGTTTCCATTTCTTCTGTCGTGCGATGCGTTCTGTTCAACAGTGAAGCTCCTCGAAGTCGTGCATCTGC
ATGTACCACGTAGAGCGGGGCGGCGTGAGGTAGTGCATGGGCGCAGCTCCTGGCGGCAGGTTCTCGACCAACTTCTCGCGCAGATCAATGAACTCGTCCG
TCTGCACAAcgttgatcttctcgttgtCCGTGGGGATGGAGATCTTGCCGCTCTCGGGCAGCATCACAATAGGGAGCCGCTCCACCACGCGGTCCTCCGT
CGACCATCGGTCGCGCGAGATCACGTGCACATTGAGGGTGGAGAAGGATCCGTTCATGAACCTGTTGGAGATGGTGCTCTCTACGGAGGGTTCGGgggcc
tcttcctcctcctcttcttcggagcAGTAGTAGGCCGGACAGGTGCGTCGACGACGGGAGTTGTGGACAttattgctgttgctgttgctgttcttggCGA
AGAGCGAGCGGCGGAAGCGGTCGCGCTCCTGACGGCGGGTCTCTAGCATCTCCTCGCGCGAcatgcgctgctggttggcgcTGTCGTTGACAGGCGTCAC
TTGGGCGCCGCtgtggcctcctcctcctaggaagctgccgttgctgctgctgccgctatTGCGACTCGTGCGGTTGAgcgccttcagcagcttctgcagc
gccaggaacgtctcgtccacctcctcgtcctcagcGGAGAGACTAGGGTCGCCCTCTTCGGACAAGCGACCGGCGTACGACGGCATCTTCTTGGACAGTC
GGGTGTTCTGCCTCTCGACGCTCGCCATCCTGATGCGTCGTCTCTCTGGGAAGTATCTAGCTGTAGGTCTGCGATGAAGGGCGCCTCCTGCTCATATAGT
GCGATTGCGAAATGGGAGGGAgggctgtagctgctgctggtctcACCTCCAAAGcgcctggtgctgctcgatgtTGACGTCGAGGGCTTCTTCGTGGCGG
TGGACAGAATTGATTCTGCGACGCCCGCTTCGATGTTCCCAAAGACACGGGATCGATCGGTTTGCGCAGGGAATCAGCGCTGATAGGCTGAAAAGCGCCA
GATCGGTCCTTCTTCGAGACTTGCTTCAAATCTAGCTATCTTGGTCGCCACAACATCCCAGCtatgctgctggtggcgttgaTGCAGCGGATGCCGAGCG
CACGCCAGCATGCGACAATACTCATGCTGGCGTTGGCAGCCTGCATCCGCCATCGCCACCCGCGCGCGCATCCTGCATGCGCTGACCCTGGAAAAAGGCG
TGGATTAGGGTTGATGCAGGTCTCTTAGCGTAGCACACTGGCTGTAAACTGCGGGGTGCATCAGATTTGCTTGTAAAACGGCGTTGGTAACGAGACTTGC
ATGCTTTGGCGCAGAGCTCTTGCCATCCCAAGTTCGCTGAGCATTGCTTTGGTTGCCTCTCTGCGTTTACAGCGGCAGGTTATGAGCCCACCAACGAGGG
CCTCGATGCAGTTGAGCGGACACTTTCTATTGTCGTCGGCCATCTCTGCGCTCCTCAGAACAGTCCACCGGTAACTGCAACTGTACACTGGTTGTAGGAT
ATCACCGCGTTGGGTTGGGTTGGGTTGGGTACCTGGCAACAGGCTGTTGAGGCACGGTCTCACCTTctctgctgccgccgccgccgccatcgaaAGCGTG
TCGCACTTCGATGCAGATATATATGATGGCGCGCAATGCGTATGCTCGCGCTtgggcttgggcttggaGGCAACACAGCAACTGTAATCTCGTGATTCTA
ACTTGACCCGTCATCAGCACTCCGTTTTCTGTTCGACGATGTgcgccacttcaacttgacgaCCTTTGGGACCGTCACTTCAACTCGGTCCCGTCGAATC
GCCGCCGTgatggcggagctgctgctgcgctggctCAACCATGAGCTGGAGCTATCGACGCACGTGacggacgtggagaaggacttCGCCAGCGGCTACT
TGCTGGGAGAGATCCTGCACCGCCTcaaccaccagcacaacCTGGCCGCCTTCatgcgcagctccagcgccgacgccaaAGTGCTCAACTTCTGTCTGCT
GGAGCCCACTTTGCGCAACCTCAACGTCAACTTCGACGCCAATGTGGCCACCGCCATCATGAACGAAAAGAAAGACGCTGCCGCCAACCTGCTCTATCAG
ATCAAGGTCCGTTCTAAAGAACGTAGAAGATGTCCAATAAAAAACGCTAAACCATTGAATTTCTACCTGACAGATCGCTGCTACTCGAGTGGGGAGAGCT
CCTGGCGTCTCGACCAAGTCGTTGGAGCGCACGGGGATTATCCCTCTGCACAACAGACCAGTGAAGCTGGCGAAACCGATTTATGATGCGGAAAAGCATC
GGTGGTTTGAGCATTCGGTGCGACGCCATGTGCGGTCCATTGCGTCGTTGCAACTGGAAAAGTGGGTGGCCAAATGTGTGTGGGTCTGCGTATGTTGTGG
TGGAATTGACGGTGGAATTATGCGATTTGCTCACGATGTTGTAGAGATCAAATTGAggctgaagctgctaaaCGGAAGAAGTatctggccaagatgaagg
agcagaaggaaaCGCTGGAGGCCACCAAGGCGGACAGACTGCATCGAGCGTACATTCACAGTAGTTACATTAAGGAAGCTCTTGAAGAGTCGGACTCGCC
GGCGTGGAgactggcgctgcagaaaaAGAGTGCACGTGAACAGCGGCGAGCAGCATTTTTCCAGCaactgatgaagaagcgcgaggaaGCGGAGGTGTGT
GTGCTGACGAGGGGAGGAAGTTGATCGTGGTATAAAGATCCTTGACGGCGTGTTACATGAACTTGTGACAGGAAAATCTCACCTTCAGTTTGAGACGAAA
GGTGCAAAATGACCTCGATGAGTTCGATGTACGTTGCGTAATGTGAAGTTTGTTTTGTCTGCACGTCTAACGAAAAGTTGGTTTCTTACAGGGAGGCTCG
AAGGCATCGACTGCAGGTGGCAAGGTTTCTTCGCGAAAGTCAGCTGGATATGGTCTACGCTCGCTTACGACCTCGCTCAATACATCctccgacaagaaga
aataTTCAACTTCAAATTTGGCAGGATCAGCGATGAACGAAATGGAGCTGTATCATTCGAATGTGCTGGAAATGAAGAGCGCCTCGGGTGTTATTAAGCA
GCAAAGACAACAACGTGAGGGGCGCAAGGAGAATTTATCTCGCAGGAGAAAGCGGTTCGTTCAAGAATGCGTTTATACCCACTCTCGAATAGGAACCGCC
CGGGTGGCAAGTATTTTGGAGGATGTGGTGCTACGAGATACAAACAGTGAGAAGGACATTCAAGGTGAAATGGGGCGTATTCTCACGTACAAAAAGGTGG
CTCAGGAAAATAGGTCAATGCGAAACCAGGAATATGTGAACCAGCAGGAATTGGACTCCATGGCGACGATTGACCGTGACACGAGCTGTTATCACAATTT
GCTCCTTCAATTTGAAGATGACACCGAAATGCAAGTTATACAACGAACCAGCGTTCAAGTGTCTGTTGATGCCGCAGACCGTTTTCTCAGCGAGCAGATT
TCAGGCGCCATCATGAAGAACCTGGTGGAGTTTGTGCTTTTTATTGCTGGAAAGAGGGAGGAAACACTGCACACCCGAGACCCCACGGTTTTTCTGACTT
CGGAGTCATGGAATGAGTACAAATTTAAGTTTGTGAACGGCTGCAGACTTGAAgattcatcttcgtcgtcgcttaTTGAAGAACCCAGTCAAGACGCACT
ATTGGATAGTCACGATTTAGATCAATACCTGTCAATGTTTCAACCATTTCGTTGCACACCCGATCAACAACCTCCTGCTACAGCGATTAACGATGGATCT
CTATTTCTTGGAGCGACGGAGGTCCTTGAGAACTTCTTTGtgcttggagaagaagttaAGTCATTGCGGTGGATCGCTCGGTTGTCGGCATATTCTGATA
GTGTAGTGGAGAATGGTGGGCCTGAAGATATCCATGGTGGGCCAATTGCACCCGTATCTAATTCGCCCGCGACGAGACCACACCAGCAACTCCGAATTCT
TATCTTTGGCCCTCCGTTTGCTGGTAAAGAAACACAAGcgaagcttcttggcgaaaCACATAATTTGGTCGTGCTATCAATTCACGATCTCATTCAGACT
GCTATTCAGAATTCGAGCGAGATTGGCCTGCAAATGAAAGATCTACTGGTCAATGGCAAGGAGATTCCATCCGAGTTGTACAGCCGTCTTGTTATCGAAT
CCATCGGGAGCACCGAAGCACAAGCAGTTGCACAAGAAAGCACGTGCAAAACTGGTTGGGTGATTTGTGATCTGCCTGCTACAGAACAGCATGGTCAGAA
TTTAGAGGAACATCTTACGGGATATGTGGATCCGGCGCTTATTCCTTCTCCGTATGATTTTGAGTCGGCTATTGCTCCGGGCCGCAGCAAGCCTGTCTTG
TCGCCGACATTTCTTCACGGTAAATCCGGCTTTGATCTTGTTTTCCATATTGACTGTCCTACTGGTACTGTTTTAGACCGATGCTTGGGTAGAGTGGAGG
ATCGTGCTGCAGGTGACAAGCATCATTTAGTATTTGATCCACCACCGGATGATTCAATTACTCGACATCGACTGCAACATGTCAACCCAAGTGCGAATTC
CAGTGAGCTTCTTTCGCTCCACTGTCTAGCGAGCGACGAGTTTTCTTGTGGCCACAAGGCTTGGTACGTTAAGTTCAAAACAATGCACGAGCCGTCTAGT
GACGGGATGACCGTAAACGAAGTCCACGAAGCTATCGCAGAAATCGTAAACCAATTACTGAAAGAACGACAGGATACGGCGGAATCaaaacagctccagc
aggaGGCAAGCGAGCAAGTACTTATGGAAATTGAAGAGAACAGACAAAGACGCCTGAACGTCTTTGAATCGGACATCGATGAGGCTAAGGTGGGTGTGGC
CAAAATTGAGGCAGCTATGGTGGGGGCGGAGGAAGCTAAAGcaaagaaggaggagatttTGGAGCTCCGTCAAAAGCAGGATGAAGCTCAACGTCAGCTA
GACAGTGTCATGGTGGAGGTAGAAAGCTGGATGGAAAAAGAGAAGTCGCACCGCCCTGCGCTAACCCGCCTGTATTCGGGCCGGTTGGTACCAGCTACAG
CCCATGCGCTGGCAGCATTGTGGAATGGCATGGAAGCAGAGTACATTTCTACCATGAAAACAAGTTTTGCATTGTTACGAGCTCAGCGGCATCTCGTTAC
CAAGCACGCGCAATTATTGACGATCGAATTTTGCGAGTTTGTACGACGTCCCGACCAGAAGCAAGATATTGTTAACCTGTTTCAAAAGCAATTGAACGAG
GTGGTTGACGAGATGCGCTTCGACGATCTGACAAAGCTAGAGCTGCATGCTCGTGCAGATATCCTGCAAGACGAATTGGGGTCTGTGATTGAAGCTAAAG
TTTCAGAGAatgacgaggagctcaatAGTATGGTTGGTGACGGGTGGACGGTAGATGCGTGCCAGCGAGTCGCTGTCATTTATCAAAAGGCACTTCAGGC
GGAGTGTGATCGCTTTCGGATCTCtgtccagcttcttgtagATGGCTACTACGCTGCAAGCTGTGATTCTCCTCAGCTAACCAATATTGTGGAGATATGG
CATGCGCACCAGCCTCGTTTGGATTTGGCGTGCAGAATTTACCGGGACCCCGCGAATGAAATCCCGGTAGAAGCTCCGTCCGCACCAGTTGCAGCTGGGA
AAGCTGCTCCAAAGGGAAAAGCAAaggctgctgcacctgccgTCGTAGCCCCAGTCAGCGCTGCATCTAGTGAAGAAGCTCTAGCAGAGGCCCTCACTAT
GGCTGAGCTGCTAGCAGAGTACAAGCATGTACTCGAACGATGTGGAGCATGGATGGAAGCCATTGCTCTGATTGCCAACGCTATGGATGCTGAAAAGGTT
GtagaaggaggtgaaggtgtACAACAGCAATCCGAAATTGATACCTGCACAGTGAACTTGCTGAATGGGATCAAATACGAGCACGACTTAATGGAGCGAC
GCGTACGATTCCTTCAAGAAGCTACCGAGAACTCCTGTGACGAAATCACGCGGTCCATGCGTTCTATCGAGTTCACCTTGCGAGGCGTTCTAGAAGACCG
GAAAAATCGAGAGCAGGTTGCTGTGGCTGCACTGATTGAATATGTGCGTTCTGCTATCGAGGATGAAGTCGCTCTTCCGTCCTTCGTCGATGTCAGTGTA
AGTGTGCTCTCGATCTTTAATTGTTTTGTTTGTCTTGCGTGGTCTCAtcaatttgctgctcttgtaTATCTGCAGACTGAATTTGTCGAGCGGTTCTCAA
CAACGGCGCAGTTCCCTGAGGACACAATGGTGCGTGTCGATGGAGGTAGACGCTTGTTGTCTCGAACTCCCCCCGATGCACCACCCATCGTTGAAGAGAC
ATACGAGCTGCTTCTGAATCCTCGACAGCGCGGTTGTCTTCGAGAGGCATTAACCTCTCAGACTATCGACAACTCAGGACTTCTCCCGCCCATTATGTTA
GTGGAGACGGTAACAGCTTTAACTTCTCTTCCTGACGCGCTTCCAGACGTCTGGCGTCGGTGTCCCGCACACGTCATCGCAGAGGTACGAGGCCCATCTT
TTGCCTTTTACCATCCGTATTCGTTCTAACTGGCATCGTCACTGCAGGTCGCCGCAAAATTCACCATGCAGCAGTCCTCcttcgtcgacatcgagGCTCT
TATCACTGCCATGAGCACCCGCgacgatctcctccatcagttccaagaagacgaaacTCGGGAGCACCTCGAGCGACGACACCAACTCGACCTACAACgt
caacaagaacaagagcaCGAACTCCTtctacaacaagaagcacaacAGGAGAACGAAGCCAGCAACCCTGCAGTAGAATAACACAAGAAAAGTACACAAG
AAAGAGACCGTTGCAGCCGTGTATTCCTCCGTCCTCTCCCCGCCTGCCTGCCGTCCACCTCTGTGCTCTCTATATCGCTGGTGACTTACAGGATGACGGG
GTTTTCGCCCACCTCCTGCACAAAGTCGTGCTCGTCGCCCATGAagatcttgagcttcttgtcctgcagcgcgcgcaTGCGGTTGCGGGGCAGCATGCCG
AACACGGCCTTGCGCAGCACCTCCTCCGGCTTGcgctcgaacagctccttggccgtgCGCTGCTTGAGGCCTCCCGGGTGGCCCGTGTGCCAGCGATATA
ACTTATTATTCCACTTGTTGCCCGTGAGCACGATGTCCTTGGCGTTGATCACCACCACGTAGTCGCCGCAGTCCACGTTCGGCGCGTACGTGGGCTTGTG
CTTGCCGCGCAGGATCGGCGCCAGCTGCGACGCCAGGCGACCCAGCACCTGACCCTTGGCGTCCACCACGTGCCACGCCACCTTGGAGGCCTGCGCGATC
TTGCTCATGCTTCCGTCCTTCCTGTAGCGCTTGCTGGCCGCAGAAATGCCCAATTGACAGGCCACCCGTCGTCGCTCCGAATATTTCGTTCTAAAATGGT
TTCAGACTTTAATAAAAAACCATTTAGAACAAAATAACAGAGTGGCGAGATTGAGCAAAAATGGGCCGCTACACGACGTTCAGTGACCAGGACGCGCAGG
GCGCCGCTGTGCCCTACAGTGCGGCCACAACCGCTGGGAACCCCTCTGCACCTGCTGTGCCTTCTACCGGCGATGCGAACGATGCCAAAAATCCCGTCAA
GCTGAACGTGAACCGCGTAGACAACGTGGCAGGAAGCTCTGCGGGTGCTGGCAGCGGCGAGTTCCACACGTACCGCGCCTCTAGGAGACGGTAAGGTGCT
GCAATGTGTTGATTCATAAGAAATACTCCGTTAGTGTGAATGACGATGTGTTTGTGCAGAGAAATGGAGCGCGTGGCGGCCATGGAACAGCGCTACAAGG
AGAACAAGGCGCAGATCGAATTCGAAACCAAGCGCAAACGCAACGCCGAGGagttcgacgccaagatgcagaagcgcgCGGAGAAGCGGCGACGGCGCAA
AGAACGAGCCAAAGCAAAAGCTCTGGATGCAGttcaggaggaggaggaggaggaagaagagaagaaggtgacggaggaggaggaggagactagtgcagag
aagaaggagcaggtaCCCGAGACACCTGGAGGCGTCCCGGAGATTCCTAATgatggcagcttcttggaaaAGATGCTGGCTCTGCAGGAGGAGAGGAAGG
AATGAAGTTGGTGAATTCTGGCCCAGGTTTGGTTAGATTTTTATATTGGTATTCATTCATGTATCTCCTGTGCTAACACGCATACAAGCGATTATCCTAG
CTAGTTGTCGTCCTGGAAGACCAGTGCGACGCCACGTAGCACCCACTTGGCACTGCCGCAGTCGGTTGGCAGAGTCGCCAAAAAGATGTACGTGTGGCCC
CGGAAACGCGTTAGGTAAACCGGACACTCGTAGGTGTTGGGGTCGTGACGCAGGTAGCCCACGGACGAAggttcccacgttggttgtGTGGTCACGGCCT
TGACGTAGATGACAGGCATGCTCCAGGGCAGCTCCTTGGGGTTACTGTCGAGCAGTGTACCACCGCACTCTGTGGGAGGCGTCGCACCGACCGGGTAGCG
TTCATTGATCTCGTCCAGTGTGCTCCATCTTGCCCCTTCGAGGATAAGTCCGTGCACGAAAACACCATCGTCTGGGTAATATGAGACGGTTGAAGGGTCC
TGGATCGTGCTCACGTGGGTCTCCACCGTCATCTGGTTAAGAGGCATGAACCGCTTACGAGATGTGACCTGCAGACACGCCGTCGTGTAGGCGGTGGGGT
TGAAGAGGCCTGGCAGCCAGATTGAGAACGGCGTGACAAAGcaacttccacctcctcccGCTGTATCTCCAGCCCACATGACTAGTTGCTCGTGGCGCTT
CACCATGTCAGCAAACCAGCCGCTCAGCGACTTCGTAGATGGCCAAGCCTTCTTCTCCCACTTACACTGCGAGAACGGGTTGCGTCCAGGCACTTCGTTC
AATGACATCGCTGTGGCCAAGTCCTCCATGGCTTGTGACATATTGAGCTGTCCGTTGAGACCCTTTTTCAGGTCGCCAAGCGATAGACGGATCTCCTGTA
GCAGCACGTTCATGCGACTGCACTCCTGTAATGCCACAACCACGAAAGGACCGTGGTCCTCTGTCAAATGAGGTGTTGCAGCCTCCACAACGTCTAGCAT
GTTGAAGAACTCGGGACAGCGAGCTTCCAAGTCGTCGATGGAAGCACGCAGTACTGCCGTCTtgtcgccacctcctccttcctctccacctccacctcca
ccagcacctccgcCGATAGTCACAATAGTGTAGCATAATGTTTCGCACGTCGTAGTGAGATAGCCGATTTCAGCATTTGGGTGAAGCCCAAAGAGCGGTG
GTGCTTCAGGAACCATATTCTTCTCGATGTAGTTGGCGTAGTCTGCAAACGAAAACTCTTGTGGATTCGGCGATTTGAAGCCTGGGCCGAGTTCCATGCC
GTTGAGTAGTCCCGGGTCAATGAGAACTGTCAGGTACGTGTTGTTAGTACGGCGATCCCAGGCGTCCGTGATATGGCCACCATACATGATTTCACCGAAC
AGGTAACGTAGATCATCCCATGGAACTGACACGTTGTTGTCCAGGTACGAATGCAAGATATTGGCGCAAATGGTGAGATCGCCTGTGTTGAAACTATAGG
CACGACTCCATCCTTGCTGACCAAATCGCCTTCGTCCCAACACAATTGCGTGGAACCAGCAAAGGGAGAACAGGCAAGCCTTGAACTCTGCTGGCTTAGT
GCAAGCTTGCACCTTGTCCTCGCCAAAGTTGGCCCAAGCACGACGTAGGTTCGACTGAATGTCCGAAGGCGCCTCATTTGCCACCTTGATGCAGCTCTGA
AGCAGAGACTCAGGAATGTTCAGCATGTCGGGTAACGGAGGTGGTTCAGCCGAGATAAAGCATCGGAACAGACCATGAGCACCTTCAGTTGCCACCTCTT
CCAGCTGACGCTCTAGAGTCGGTAGCCATGACTGCATCAAGTGCACATTTTGTAGGATGATCCAACCGCCCTCAGTGCTTAGTCGCTTTAGAGCGTCACC
AGCATATGCCTCCTGACCCTGGCCCATGGAAATATTGATGAAGTTATTGTTCTCCAGACTCACACCGTTTGCTTTACCGAGTGTTTCGACCCACGGTGTA
GGATCTACACCAGGAAACAGCACGAAAAAGATCGGAATGCTAGAGTTTGTCTCGGCGTACGTGGCCTCCATGTTGAACGGCGGCTGGGTCACGTATTCCT
CGCCCAATGACTCCAGAATAAACGTCCGCAGTGCATTCGTCACACGATCTGGTCGCATGGCGCGTAGTAGAATCAGTCGTTGGAAAGCTGTAAGCTTGAT
GAAATCTCCAGGAATCTTTTGGCGCTCGGCATCCTCAGTAGCAAACCACTTTCGCCACTCGTCGGGGTCGTTTTGAATCGCATCACCAAGACCTTGGAAG
GCCTTTGCGTTCTCTAAAGCTTTCAACTTAGCCCAGATTGCCGCAGGGAGCCACTCCGAGGCTGACCCCGCATTGCCTGCATCTGGATGAGCCTTGCTGA
TGAGGAAATACTCGACCTCTGAATCATTTAATAAACCATCCTTCAGCAAGATTTTCAGACACAGCATCGTTGCCACGGTCAGCTTGTTGCGCTCGAACAA
GCCGCGGCGAACGTAGTTGTACACACATGATGTGATGCTATCCATCAACACTTGGCAACGCTCTCGCATCTCCTCATCCGTCAGATCCGTGACAACAGGT
TCGCTATCTTCATTgtcgtcatcaccaccatcaccagcttcgccttctgtagctgcagcaaccccagcttcagctgcaggcgCAGCTTCACCTTCGCCAC
CTGCACCGTCAGCTTCGTTAGCAATAAGgttcgttgctggcggtgcgCGATAGATACCCGACAAGAAGACCTGCTGGAACGACGCGAGCGAGTAGATGTA
GTACGAGTGTACCTTGCTGATGTCATTCAtcaggaagaacagcagtGAACCTCTTGCGGCAATGCTGCGGTACTTTTCACTCGTAATGTTCACGGATTCT
TGCGTCTTCTTAGCAGCCTCCATGTTGTTCTGCGTACGTTGCGCCTTGTGTTTAGTGTCACTCAAAATTTGAATGAGAGGCTGGTTATTTGTGATATCGT
CGTCTGCACTCGCCAAGTAGAATAGAATATCATCCTCGAGCTTTTTCAGCTCGATCTTGCCGTTGTTCTGCTCCTGAATCAGCTTCTCACGCTTGATGGC
CAAATCTTGACGCTCTTTAGACACGACTAGGTTCAGCAACTGATCTTCAAGACCAAGCATCGTGACAGTGAAGTTCACGATAGTACATTCTGCTTGAATC
TCAGGCGGGTAGTGTGGATTTCCCAGCTTCGTGTGTAAGTACAAATGGAAGTTGTCGTTGTACGGGACAGAGGCGTCGCCGATTTGAATCTCGTACcgag
caccacgacgcgAAGTTGAGCGTTGAATGACCGGGGCTAGGATAGGATCAATCTTCTCTCCGAGGTTCTCGATCAAGAAGGCGCCATCAGTACCAATTGC
AGTCTTGAGGCGTTCAATCCACATCTTCTGCCCCACCCGTACAATGATGAGATTATTGTGCGCCTCCATCTCTCGAATCCACGCAATAGCTTGCAGCTGT
GGGTCGACGATAAGCGGCCGTCGTCCCATAGATACCGTTGTCACCACGATGGCACCGTTCTCCGTTGACACGCGGTCAGACGGGAGCTTCTGAGTATTCC
ACTCGGCGATTTGTGCATCGTTTGTTAGAATGAGAAGCGGGTTAGCTTCCTCGGACATGGCGATGCTttcaccgccagcagcagtccgTAAGTAGGGCAC
CCAATGCTTGTTGATAAGCTCATCACGGAACGGCTTCGTGAACGGGCCAATATACGAGATGAAGGCTGAAGCGAGCAGCACATCGCCCACGAGCAGATCC
TTTTCTttctgaagctgcaacaCGTTGATACCCCATCGCACGTTTTCGCTCGAAAGATCATTAGTCAACGTGCCTGCAAGCTTCATCTTGCGGTTTCCAG
TTTCGACAGCGTTAATTGCGTCCTCTTTCTCtttctctgctgcagcggcctccgccagcaacttgtcgagCTTAGCTTGCAGATCAGCCACAAGTTCCGT
CACTTCGGTAAGACGAGcatttgcagcttcaagttcCTGATTAGCAGCAGCCAGGGCTTGTCGCTTCGGCTCGACGGTAATGACGATATCGTAATACATG
ACAATATTTATGACCCAGGAACacaaaccagcagcagccttgtTCTTCGTAAGGATAGTATCGTAGTTGAAGTGCTCCATCTCGAGGTACACTCGCACCT
CTTTCCAATTCATAGGGGGTACCTTGCCATCATCTACGACTTGCTTGAATCCAACCAAGTAGTCAATGTACTCGGGAATGTTACCCAgtagctgcttctt
gacTGTGTCCCATTTTACATCCTTCACCTTACCAGTCTTCTGGACCTGTATGTTCGGATGCAcaccagccagcagcaccatggtAGCCGAGAAGACATCG
TCTACACCAGCAGGGGGCTTCGACATGGTCTTACATTCGCCCAGATCCTTCTTGTTTAACGAGTCAAGCGCTGCCATAGCCTGCTCAACAGCAGGTTCGG
CCTTTGCTAAGTCTTCCTGCGTCGAACGCTGTTTTTCTGTGACTTCTGCCTGGATGATGGCACACTTcgcagcttcatcgccagCCTTCTTACTTTCCGT
TTCCACATTCGCCTTCTCCTTATTCACAGCTTCTGCAATTCCAGACGCAACAGCTTTCTTgtcctcagcagcttcaaggaTGACCTTCAGTTCTACTTCA
AGACGCGACACAGTATCACCGGTCTCCTTCAGCTTTTGCAAACCTTTCTCTAAACGATCAATGGCTGCAGCATACTCCTCCACTTTCTTGCGCAGGATCT
TCTTGTATagttgaagcagctccagataCGACTTGGGCGTCGTGTACACGTGACGACGCTCAACCTGGAAAAACCTCTCGGCGCAGATATTCACCGACTG
GAATGAGAATGGCATGAACTTCTCAATACCTGCTCGGGACTCTTCCGACCCAAGTAAATCTCCGATTTCCTTCAGCTTTTCACGACCGACCGAGAGCAGA
GCTTCCTTGGGCCACGGCTGGAACCAATCAATGACCGTGCAATTCACAAGTGCAGGGAATTTACGCGCACGGTTGCGGAAATCATCACCGACAGGAGAAA
AGCACAGACACAGGTGGAGACGCTTACGGATCTCGGCCTGGAAGAACTTAATCACCTCCTTCCTGTCTTTTGTACCAGCAACGGGTGACAGCAAGTTGAC
GATATTATCCATATCCTCCATTGCGAACAGATCTGGAATCTCGCCCGAAGCGAGCAGATCGTTCAAGTAGATGAGGAACTTTTCGTTGGTGATCTGCGAG
TCTGTAAGCATAAACACAacacctccatcttcttcgttgcgAGATAACATCTCCACCACGGCCATGTGCATCTTGCGCAAGTCTTCTTTGAATTCATTCT
CGCCATACTTGGAGCTGATCGTGATCTGGCGAACAGTGTAGCCGCAGATGTGCGAGGCCAAACGTGCCAGCGATCGCTTACCACTACCTCCCACACCAAC
CAGTAGCGCATGACCACTCTCGTTACGCAGGATACGTACAATTCGAGCCACGTGCTTCACAGCATCGTCGAACAGATCCAACTGCATAGCCGTGTTGTTT
TCATTGTTGTTGTATTCACGCAACTGGACCTGCAAGTTCATCTTGAGATCATCCAGGTTTGTCCCCATGATCTGGTCGTACTCGTTATCGCCATCTTTAG
TGAAGTGGCAGAAAATGAGGGGCCACGAGTTCTCTGCAGCGTAGTACCGACTCGTATTGCACGACGCAAACGACTTTTTCACTTGCATCTGCACGAGCTG
GTTATACTTCTCGATGTCAGCCTTGCACACAAGTCGGTCGCCATACACGCGTTCACTCTCGTGTagccacagcaacacaaatTTCTCTGTACTGTTGAAA
CGATCTTTCTTCGACGCGATGAGTCCTTGGAAAACATTTGACAGGTGACGCACATTGAACTCGTAGTGAAAGTTTGCTGCCGTTTTGCGGAATGTGCTCA
CCACGCTTGCATGTAGACTTAGAGCTGCCTTGATCAAAGCATTGGAGAACTGCGAGTTGCTCAGTTCATCAGCAAATCCCGACAAGTGTCCACCTAGGAA
CGTCTCGTAAATGGTGACAAGACTTGGCGCTTCAGGCATACCCATAGCAAACGTACAGAAGTGACGCTGGAGTCGCGGGTCAACCAAGAACGAACCTGCT
GTAGGGTTCATACCGGACACCACCTGCGTGTTCAAAATGTTCTGAGGCTGAAGTTTCACGCGGTCAAACCAATGTTTATACTCCATCACCTGTCGTAACA
ACGAGATAGCACTCTGCGTATTGTATGGATCCACTTCCGGAAGGTTCAGATCATCCATGAAATAGATGAGTCGTGCCTTGCCTGGCGGACCTAAATTAAT
ACCAGTCTTGCGCTCCAGTTGTCCAAACATGGTCTGCTGCAAGATGGCACTGGTGGTGTAGAAGTTGAAATTGATAGTACAGTATCGGAATGCGGCCGTA
GCTTCATCCTTACTGAGCTTTTTCAACATGCCCATGATATTCTGCGTCTTGCCCGTGCCAGCAGGTCCGCACACCATCACCGGAACACTTTTCGAGATAA
GGTTCTCTAGCCAGAACGCAATAGATGCTGTCTCGGTAGTAGGGACAGTGATCTGGTTAATTGGACTTGGAGAAACGTACGTTTCAGTGTAGAAGTATGG
ACTCTTGGACCATGAGCTGAACTTGGAAGTCTCTGGGTCGAGCCAGAAATCAAACACCGTGTTGCTCGCCGATGCCACCAGCTTTACATCCTTCCACTGG
TTCTTCCACCAGTTACTAAACTCTGCCGAGTAGTCCGTGCCATCGTCGCTCATAGTGAGGATGGAACCAAACGACCACACACAGCAAAATACAAAGGTGT
TTTGCATCACGGTGTAATCCTCGAGTACTTGAGGCGTCAATAGACAGTCGATCATGTTCAACAGATTCGTCACTAGAGTAGTCTCCTCCACAGGGACAAC
TGGgacgagcttcttgcggaAGAATCTGAGTGTCGTCTCGACATACTGGTCGAAAAGTCCCTGGAACTTGGCTCGTGTATCCGGAGTGAACATCATGTTT
TTCAATCGGTGATCAACGGGTTGTTGGCAGTGACGATCGAGCCAACTGTCAATCAAACAGCGCCATTGGTAACCTTCCGATGTTGAAATGTACAGAATTC
CAGCGCGCGACACAGTTGCCGGCGTAGCATAGACAAGATCACGAATCTCGAAGATCATACGCATATGGACTTTCAGCGGGATACGCTCATTCGAAGCCAG
CGTAAGCATTCTattgtcgtccatgacggaGTTCATCGATTCGATCCAGTTAGCATCAAGATCGCCGTCCAGAATAATCCATTTAGGATTGTTATCTTCA
TCACCATTGTCGCGGCGCCGAGAGCCCAAATCTCGCATAATTCTCGAAAGCAAGCCATCTTTCCATTCACGCGTCTTCAACACGATGTATCCGTACAGTT
CGTTGGTGCTCACCGATTTCGGGTTCAAGTCTTGCACTTCCATTGGCGTGCCCATAATTTCTCGAGCCTTCCTTAGCGTTTTCCATGTCTCCGTTTTACC
TGAGGCAGGAGGTCCCATCACGAATACACAATGACGAATTGCCAACAGTTCTGATAACTGTACGACCTTGAGCATAAACTCCGGGCGAGGAGTGTTGCCG
ATGGCTTCTGAAGCGCCCTGTACCATCGACTCAAGCTCCATATCACGCTTGCGGGGAGGATCATTCCGTACATCCACGTTCGGACTATCACGCGGGAATa
gatctccaagaagaccaaAGAAAACCACCATATCCTCGGCAACGATTTTGGGGATGTTAAAATCTCGCAATGCTCGCATCAGTAAGTCCGTCTCAGGAAT
CTCCGGCTCGGCACGCTTGAATGCACCAGCGACACACAGCACACTCTTCACAGCTCGAAGTCCCCAATCGTAgtgcagctgcttggacaAGAGCTGTCCA
AGCAACGAATACAAACCATAGAATTTAGATGCCAAGATTTTGGCCTGGGTGAAGCCTTCTGCCATCAGCATATTCTCGCAAATCAGCACAAGATCGGGCA
CCATAACAGTCATGGGACGGAACAATGCCTTAAGACCTTCGGGCAATTCAGAACGCCCTAGATAACCAGGGTTCATAGTGATGAATGCTCCGACAGTCGG
ATCCAACATCACTTCATCGTTCTCCAGGATAAACCTTTCGTCATCAGCTTTGCATGCATCACAAACAGCCTTAAACTGGACTGAACACACCGATAACACC
TCAGGTACCAGACGATTGAACTCATCAAAGCAGCCCCACGAACCAGACGATGCCAGTCCTTTGAAGATATTCCCCAGACTCTTGAAGTCCATCTCAGGCG
AGCAGTTAAACACGTAGCACACCTTTCCCAATGCGTTAGCCAAATCTTTGGTTGTCTCCGTCTTGCCTGTACCAGCGGGACCGGCAGGAGCACACCCCAT
TTGGAGGTTCAGCGcctgcgtcgctgtcacGTAGATACGATCGGTCAGTGGGGTAATCACAAGCCGAGGGCCATTTCCGAGATATTCGTAGTCGTACGGG
ATGCCGGCATCACAGATCAGAATCTGAGCGCGAGCATTATTTGCTCCACGGAAGGTGCTATCTCGCTTTAAGAagcttcctgctgctggggagAAGTAGT
GTTTCAGCTGCGACTGCCATTGGAAGTGTGTCGCCTCTTCCACCCCAGCACGAATCATATTTGCCACGATATCTCGGCCGTGCGCGTCCATCGTGATTAG
AACCATAACACGCTGTCGCTCTGCATACGAAATATTGCTTTGCGTGAGCTTGATCAAGtcttcaagctgcttctcctgcatcttgtTGTAGTTTTTCAGA
GCGTCTTTGTCGCCACCTTGAATACCACGGAACGTACGCTCGACTTCTTGAACATAGTGCACTCCTGCTGCGAGTAGGATAATCTGAGCTGCATCCATAG
GTTTGTTGGTGTCGTCCTTGAAGTTAATCCAGTCAACGCGAGGCATTTCGGTGTACGCTACTAGCGAACGTTCAATATGCTTGAACAATGTCAACCTCAT
TGCGCGCATAATGGTCTCGAGATATATCTCTGCTTCGCCTTCCAGTATCGGAGGCTCGAAGAAATCCACGATTTCGTGACCCACACCAGCCACAAAAGAT
GTAGCAACTGGCCTTTCTCCATGCCCACGATCCACCAAGGTGAGCGTCTTCGTTGCCAAATAAATCTTGGAGCAGTGCGGCATGATCCGACCGGGATGAG
ACCCATTTGACAGAATGTCGAGCAAGTCTGCTTCAGACATGAAGTAGAAGCGCGGAAACTGGCGACGGCGCCCGTCGAGGAACTCTTTGAGGCGGTGTTT
GCACAGCTCGAGTTTTTCCACGATAACTTCAAGTCGCTTGATGAGACCTGGCTCCGTACACGCTTGCTGCACGTTAAGCGTTTTCCACGCTGTTTGTAGA
ATTTGGCGAACCTCTCTGTCAATATCTTCAAAATCCGACGTTAGCTCGGGCAATTGCTTTTTCACTTCTTCAGACTGGATGAACAATGGTTCGAGATAGC
TCCAAGATCGCTGGATGTCACCCAGTAGCAGCACGACTTCATTGATGGATGAAAGGCCGATTTGAAGTTTTGCAACGCGAGGTTCAAACTCTGATTGGTA
CGGTGACGCGCTCATACCTTGAACGTCGATTTGATGCGTCTCAAGGAGCTCGAAGTTCTCTTCTGACACCTTGAGAAGAGGCACCATTTCCTCTTCTGGG
GCGCCTGGATTGTACGCGGTCATCTCCCAATTTACCTCGGCCCATAGTGCCTCAAGTTCCACCAACCGAAGCTCGAGTTCTTGTTCCTTCTCTGCTTCGT
AGCAAATTTCATTGATGTCCGAGCTGAAGTTGAACAAGTTCTTGCTCAGGATCAAAGAGAGTCGCTGTTCCGGGTCTTGGTCCGGAGTGGAAAACTCTCC
TGTATGAAGCATAATTCGCTTCCAATGCCGTGGGCGCATGTAACTAGATGACACGCACCGAATCAGCGGGTGCGTTTTATCAAAAGCCTGACACTCCTTC
AATATTGAGGTGTACGCGTCGCTCCACTGGATCCCTTTTGGTattttcttcagctccttcagcgcaGACTGCACTTCGATCTGCAGCGCGTTCACATCCA
CTTCTTTAAACAAAATGTCCTGTGTCGCTGCAAAAAAGGCTTTCGCACGTTTAATGATATTCCACACAGTTTTCATTGCATCCGCATCCGCTCGTATCAA
GCCCATCATGCATAGTGATTCATTCATCAGCTGTGGGAACCCAAAGATTGAGCATAATTTTGTGTTCTCCTCgcatttcttcatctccataTTCCAGTCA
ACGAGGTAATTTtcgatcttctccagacCCTTATCAGGCTCCAACTTGGACGACCAGAATTCGAGAGTTTTCAAAGCCTCTACCTTTTGCGCGATCATCT
TCTCGTACGcgatgatcttctcctcAGTCTTCTCACTGAACACCCGTGTCGGCTCTTGGACGCGCTTCTCGGTGACTGGAATTTGTTTTTCGACGTCTAC
GAAAAGCTTCTCCATGCTCTcaatctccaccagctcttTGTCGACATGACCACCACTAttcttgatgttgaagaaAAGCTGTCGGACTTGGTCCAGGATC
AAGTGATTTGTCGTCTTGTCCGCCTCTAACTTGCGGATGAtttccttcatcttccgcAGGGTCTCGAGTCCATCTGATTCATTGCTTGGAATATCCTTCC
GCAAATCAACAAGAATACGCCGGAACTCTCCGTTTCGTTTGTTCATCGTTGCCATCACACGGCGAATAAGCTCTGGCGAATCAAAGTCCTTCTGGGTAGC
AAGCGGCGGCAAGCATTTCGTCTTGTTATCCTCAGAAACGGGCTGAAACTCTGCAGCGAACGGTGAACCGCGAATAGGACCCGCAATCCCACTGAATGTG
CCCGTGAAATCAACCGATATCTCGTATTTGCCTGCTCTGGGTGGCGTAAACGTCACGACATACCTGCCATCGTTCTTGTCGAGAATGGATGCAACTTGCT
CCAGTTCAGCTTGTGGATCGTCGCAACACTTCAGAGTAATAGTGAActcatctcctccacagtCTCGAGGATTGTCGTCTTTGTCTCGAGATTGAATGAT
AAAGGTGGTTGGCAACTCGGCCAAGCAGTTATCGCTGAGTGCAGCAATTAAACATGGCCCAAACGCCAACGattttggagctgctgtgaCCGAGTGAAAA
CGGAATGAAGTAGCGACGTTCGTGTACATTCCACCAGATAACGACACGCGGACCTCAGCGGCTAATGCCCCAAATTTCTCGAAGTTGGGAGCGGTTGCCT
GGAGCACAGTGGGGCTGAGCACAGCTCCTTGGACATCTACTGAGCCCTTTGCAACTGCAAAACGTAAAGTAGCATTTTGCCCTGTGAAGTTGAAACCAGT
GATCTTCACCTTTGCATTTCCTGTGATCGGTCCTTGCTTCGGTTCGGTCGACGATATTGAGTACGGTGGTCCGACGATCTCGCTTGCATTAAGAACATGT
AGGTCATTGTACCAGCGGTTCGCCCAGCCTCCAAAGAAGATCAAGTGATTGGTATTCCCATCAAACACCATCGCAGTATCAGCTCGTGCCTTCGGGAGTT
CCCCTTTCACGGGCGGGTTAAGCCATACCATACTGCCAGTGTCCAACACCGTCGTGCTGTTCAAGTACGCTCCTTGTGCCGTTCCTGACTCCGCCAAATC
TCCACTATTACCACCAAACAAAAACACTTTCCAGTGAGGTACAGCCGCGACACTTACACAGGTGTGATTCCAGATAGGAGAGTGGAGCGGTGTGCTCAGC
AGACTCCACGTCTTGGTGGGCAAGTCGAAAACAAAGATGTCTTGaaactgcttgaagctgttccAGCCGCCAATAACCAGCAATTGCTCCTTCACCAAGC
ATGTCTGATGTCCCGAACGAGGTTCTGGCTTTTCACCCTCGGTTTGGATCTCTTGCCATTTGAACGAGCGCAAGTCCAGAGCGTGCAGGTCGTTGAAGTC
GGTGCGACCAAAGCCGTTGCCGCCATATCCACCAAACACGTACATTTTTTCACCAACAAGCGTGGCACTATGAGCTCCGCGGCACTGCGGTAGCCCCTCC
CAGAAACCCTGGGCGTATTTCTGCTCCCACACCTTCAATTCGGTGTTGAAGATCCAGAGGTCGTTCATTCGCTTTTCAGCCGCGAAGCCTCCAAATATGA
TGATGTTCTTTTCAAACAAAACGGCCGAGTGTCTCCATCGTGGTGCCGGTACGTCGTCATCACTCTGTGGACTTGTCACCTTGGACCACGAGTACCCTAG
CATAAAGTCAAACGGTTAGCCAAGAATATAGAATGCAGCGGGTTTGTTGCTTTATGTCACAACCACCCTACCGTTTGTGACGTCCAACCTGTACAGCTCG
TTAGTAGGCCCTGGAGGCGATTTGTGATCGCAACCGCCGAACATGTATATTGACGTTTCCGTGTCTGAGCTTTTCAACGTGAACGAGTGCCCGGACCGCT
TCACAGGAACGTCTCCATTCTGTTTTGGTGCAATCCACGCAAGTTCCGGCTCACATCCGTACCCGATCGGCTGGCAAAAGCAAACAATGCCAATAAGTTT
CGTCAACCCATCGCCGTACATTTTGTCTACCCAAGCAACTCACCATTTCAGCTTTGCCCTCAGAGAGATGCCTAGATATGAAGTCTGCAATTCTCCGCGC
GCTGTAAACTCTCTCTTTACTTGATTTGCGTGAACGCTATCTCACCCTTGTCGTTGGTAGCTTCGCCACCAAAACCTGCTATTGCACACACGGAAAAACT
CCACAAAAAGGCAACCTCTCCATTCAAAAGGCGCGTGAAAACTGCGATCTTCGTGAGGTTTCGTTTCGTCCCTTCACGAAAGTCCGTTATCGCCCTGCAA
ATACAATCGCAGCAAATGAACTTTCTCGCATGAACTCCTGCTCGATATCTGTAGACCTTTGTGCTCAAAGCGCATGCTTTATTTCATTGCGGGTTGCTCT
GCAACCGTGCGCTTGAACCGGCAAGCTCTAGACGCGAAGACATCATCTGCAATCGGGACTCAAGACCCCACACCACTCTTGAATAGAGTGCTATTCCATT
GCACCGCGGTTGCTCGACTCACTCAACACCACTGGGGCAGCAGTGCATCCACCTAGttgttgaacttgaagaaaATAATGTCGCCGTCCTGGAcctcgta
cttcttgcccTGCTGTTTGAGCTTGCCAGCCTTCTTGACGGCCTCTTCCGAGCCCACTACAAATCCCAAACGCAACATTAGTTCACCTCGCATAAACCAT
AGTAACAACACAGCGGTCAAACGTACGCTCTTTCAGGTCGGCGAAGGCCTGGACTTCGGCCATGATGAAGCCCTTCTCGAAGTCCGTGTGGATGACACCG
GCCGCCTGGGGTGCAAATCGACCCTTGCGGATGGTCCATCCACGCACCTCATCCTTTCCGgccgtgaagaagtggatcAGTCCTAGAGCCTGGTATCCCA
TACGGAGCACGCGGTTCAGGATCGACTTGTGCGTCGGGTTCTCCTTGAAGTACGTCTCCAGCTGGCCACCGGCCTCAAGGTCCAACAACTCGAGCTCAAA
CTCGCAACTGAGCGGGATCACAGGCTCATTTCCACCGCGCTCCTTGATGTACTCGGCGATCTTGGGCAGGTACTTGTTGCCCTTGCGCAGGTAGTCGCGC
TTGCTCACATTGATGAGGTAGACCACAGGCTTAGCGGTCAGCAGCTGCATGGTGttaagcagctccacctctTGGGCAGTCCACGTGCCGAAAGATACGT
CCTTGCCCGACTCGAGCCACTCCAGGATCTTACACAGAGCCTCGtactccatcttcttctccttgccTCCAACACCACGCTccgcgagcttcttgacaCC
GACCGACTCCTTCTTGACACGCTCAATGTCCTTGAGACGGAGCTCCTCCTGGATGATCTTCATGTCCCGCACAGGGTCCACGTTGCCCTCCACGTGCGTC
ACTTCGGTCGAGTCGAAGGCGCGCACCATGTGGTAGATGGCGTCCACGGCCTGGATGTGCGACAAGAAGGCGTTGCCCAGTCCGGCGCCTTCCGCGGCGC
CACGCACGAGGCCGGCGATGTCcgtgatggagatgacgggAGGGACGACGCTGGCCGGCTGGTACTTGTCCACGAGCCAGTTGAAGCGCTGGTCGGGCAG
CGGCACCACGGCATCGTTCGGGTCGATGGTGCAGAAGGGGAAGTTCTCGGCCGGAATGTGCAGCTTGGACAGACAGTTGAAGAACGTACTCTTGCCCACG
TTGGGGACGCCCACGATGCCGATCTTGACGTTGTTACCGGGACGACCCAGGTACGTGCGCGTGggctgaagagaagaagagcataCAGTTAGAGAAGGGG
GGAGAAAAGTATGTAGATTGTATGGGGAGCTTAAGGTACCTCTTCGGTCTTCTTTCCCTTCGGCGGCATGATGCTCTTGGTTCTTGGTGAATAAAGCAAT
GGCGCTCGTGAGCTTTTGAACGAAATAAAATTTAACCCTTTTGGTGGAAAGGGTTAACTAGGGTTACGAAATGGGTTAAATCCcaggcaagaagaaaata
aAACCATGAAAAGCTTCATTGGATTAGCGTGGACATAGCGCTCGTAGTCGCCACGTTCACTGCAAAATAGCAGGATCTAGAGCATTTACAAGCTCGCTTG
AGTGTCGTTGCCAGCGGTACCTCCAGCCTTGACTTGCTGCGCCAACCTGTCGGTTTCTGAaaatcagcagcaaaaacatcGCACTGTTAAATACTGTTCG
AACGAGACACACAGTGACTTGTGACTTACCAGCTTTCTTTTTGGCGGCCGCAACTCCAAGGGCGATGAAGACCACCGCCATCACGGCTATGAACGCCCCG
ACGCCTACGAAGATGGCCTGCGGAGCCGAGTCCGAGCTGCTCAGTGTCGCACACGAGGTAATATCCTTAACACTGCAGTCGGTACCAGTGTAGCAGGACA
AGCAGCTGCACGACTTGGTGCCGTTCGACTCCTTGCATTGGCCATTGCCACCGCAGTCGGACGTGCTTTCGCAGGTGCCACCGCCACTCGCAACCTCGTA
CGTGCCGCAAATGTCTTCTTGGGTCGTACCGACGGTACCGCTCAGCTTCACATCACACGTAGCGCCACTGTCCGTGCAGACCACGCCTTCACGGCTGGAA
CAAGTCCAGGAGTCTGTGCTTGCGATCTTCAGGTAACTCGCGGAACAACCGCTCACAACCCAGCCGTATTTGGTCGCAGCTTTGTTGGTAGACTGCGTTG
TGGTCTCCACTGTGGGCGTCCACGTGCACTTAGTGCTGTCAGTCCATTTTGCATCGTCCGTGTATCCTGAGTACTTGGCAAACTGTGCCTTCAAGTTTGT
GTAATCCGTCGTGGATTTTGAGCTCGGCGTCGACAAGAAGTCCGTGCTGCCACCTACAAGACAGAAAACAAAAAATCAGTTTATCAAGCCATTGCAAAGA
CTGAGCTAGAAAGTGGCTGTACCTGTGAACATCGGGAACAGCGAGTCCGCTGCAAGTTTGGCCTCACCATACGAGTAAGCCAGACCACCAGACCAAACCG
ACGTGAACTTCTGCGTTTTCGCTGGTTCTTGATACAAATACGGGACCATCCCCCAGTCACGAGGAGTCGCGGAAGAAGTCTTACAGCCGTACTCGCCAAA
ACCAACCACAATGGGGATACCCTGCGCCATATTGATGTAGCGCTGGTATGCCTCTGCGAACGTCGAGTCCGGGCACCAACGGTACTCATTGATCAGGTAA
ATATCAATACTCGACCCCATCATGCCGTTCGTCATTTTGTCACCACACAAAAGTCCCTGAATCTTCATCACGTGGTAGTCATCGGCGTTGGAGATCTCGT
CGTTACTACTGTCAGCAGCGGCGTAGGCGAGCGGTAGAATACGaatcttcttgccgttcacCGACATCCAATTCTTCAAGTCAGATACATAAGCCTTGAC
ACACGATCCGGCAGTCAGGTCTGCCTGCATGATTTCATTTGCCACGACAACACCGAGCGTGTTGTCGTACTGGGCGAAGTTCTGGATAATCTTCTTGCCG
TactcaagcagcagtgccgGATAGCAGGTCTCCGTCTGgtccaccgtcttggcgCCCGTGCCAGAGGACACTTGACccgagcagctcaaactCTTGGTGA
TGGTCGAATAGCGGTACTTGCCGTAGTACGCGTCGTTGTCAGGAGAGGCCGAGACCATCACGTACACTCCAAGTGCAGCCATGTCGGTCATGAAGTTCTT
GTATGAAGACGTGGGGTTGATGTTGTACAGCCGCAGCGTGTTGTACTTGAGGCCAGACAGATTCTCCTCGATCGCGGCCTTCGAGTACTTGTCATAGTAG
TCGTCACTTACGGCGTATTCGTACGTTAGCTGtaaaacagcagcaattagAGATCGAATAGAGTTAGCGTCGACTCTATAGAAACTGTGCTTTGCTGTTA
GTGACTCCTTCCTATCCTATCCGGCCGTTCGAACGCACGTACCCctttgatgaagaagcgctcTCCCGACTTGGCGTTGTAGAGTTTGTTGCCGCGCACG
ACGATCACGCCGTCGACGGCCGCGGCCGCCGTcatgtgctgcagcagagcgaaggCCGCCAGCACGGCCGCGAGCAGCAGGCTTCGTCCCGTCATAGCTA
GCTATCAGTCAGTGGCTCCGTTTTTCACTATGAAGCGGCTCTCCCTTTTCTCCTCGAACAGAGATATTTCG