Description :
From Genome Similarity Track
Location :
Scaffold_79:50780- 51880
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_79-snap-gene-0.50Microtubule-associated protein EB1

Sequence
1100 bases(100 bases per row)
TACATTTCCTCGTCCTGAGGCTCGACCCCTTCTCCTGCAGCAAACTCTTCCTCGGTCGCGTACAAAATCTTGAAAACGTTCTGCGCGAGCGGATTTGTGT
CTGCGCCTTCCGTGCCTTGCAGCAGGATCTCAATGTCGCGCAGCTTGCCAAAGTAGAAGTCACGCTCCTTCTCCAGACCTTCGACCTATTCCGCGAAACA
AAACAAAACAAAACAAAAGGCATTTGAGTGAATGAGGAAACGAGCCATTTCATCGAGCACAAAAGCAGCAGATTCAATATTAGCCGCACGTACCGCCAAG
CGCAACTCTCCATTTTCATTCGTCAAGGTCTCATTAGCGCCAGTCAGTTCTTCTAACTCGCGCTCCAGTTCAGCGTTGCCTGCGGCTGCGACAGGAGGAG
CCGGAACAGCACCACCTGCGCTTCCCACTGGACGGCGAGTGGCACCGACAGCACTCTTTGCGCCAGCGCCCACTCGAGATGCACCAGCCACTGGCGCTCC
TGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAGGGTCGAGGTCGGCTTTCTTCTCGCGGCCGCAGCGGCAGTCGCACCAGCCGGTGTTGGCGACGG
CGCCGAGCCAGCGCCACTTCCTCCAAACTTGCTCGTGTACAGCGCACCACCCTTACCCTTTTCACGCTGCGCGATCGCGTCGTACGGCTGACCGGACGCG
TTCAGCTCGTAGAACTTCTTGAACCACTGCATGAACTCGAGGTTGTCCTGGTACTTGCCGCGCACGAGGCGGTCGACTTCAATGTGCTTGTCGATCTTGA
GGTTCGTGAAACACTTCTGTAGCACCTTGTAGTTATTGATGTACTCGTAGTCCTTGTTCGCGCTCCAGTCGACCTTGGACATGGGCACTTTACCTGGGTA
CATCGAATCGAGGATCATGCACGCGACCGCGCCGGTGCATGTCTGCTCCACTTTGCTCAGGCTCGTGAAGCAGATGCCGTTCACCCAGTCGAGGATCTCC
TTGCGCCCGACAAAGTACGTGCCGTCCATCATCGCGATGTTCTGATCTGCGGCCGCCATGGTGATGCTCGCTGGTAAATGAAATGCGTGGTTTTGGGCTC