Description :
From Genome Similarity Track
Location :
Scaffold_937:5078- 8996
Sequence
3918 bases(100 bases per row)
CTTCCTCTGACGCTAAAGCTACGGCAGCCCCGCTGCACTTGGTAGCACTTGTAGTCAATCCCGCTCCTGAGTCGGTTGACTATATCCTCTGCGAGGATGG
AACACCCCGTGTTCGCGAATTTGCCCCCGGCGCAGCAGGACGCGCTTACTAAGCTTATGTCCTTGCTTGGCCCGGAGGGCGTGGCTCATCTTGCATCGCA
AGGTCCAGAGGCGGTCAATGCCAGGCTGGAATCGTTCTCCCGCTACGAGAACGCGCTCTTGGAGCATGTCAAAGAGAAGATGAGCGCCGCAACGGCGGGG
GCGTCGATGACGCGTGAAGAGTCTATGAGACTGAAGCCGCTCATGGTGAGCGTAAAAACCTTCGAGGGGAAGGATGGAGAGAATCTCCTTCTCTGGACCC
GTGAGGTCGAGATGGCCATGGGATCGGCCCTGCTCCACTCTGAGCATCAGCGCGTGGCGCTGGCTATCTCCAGGCTTGGAGGTCGCGCTCGCGAATGGGC
ACTAACGTGCGGCACGTCTGTTGACGCTGCATTTCCCACTTGGGATCAGCTGAAGCAATAGCTCTCGCGCGTGTTCGCGCCACCTAATCAGGCGTACCGT
ATCCGGTCGAAGTTCCTTGCTACCCGCCAGGGTAAGAAGGAGTTATTGGACTATGTCCAAGAGTTGAGAACTCTTATCGCCGGAATGGCGGCGGACCCTC
TTCCAGAACTGGTCAGCGTGACCGTGTTCATGGAGGGACTTCGTGTGAGCGCAGCTCGAACGGAAGTGTTCCGTGTACACCCTAGCTCTTCGAAGAGGCG
GTGAATGTGAGATTAAATGCCGAGCACAACTTCAGGTCGGCTCGACCTGGTTGGAGCGCTAGTAGCGCAAGCTCTTCGAGCGGTCCAGAGCCGATGGACC
TCAGCTATGCTGAAGATGAAGAAGCGGAGCTTCTTGCTGCGGAGCAGCGTGCCGGCATCCGCCGATGCTTTGTGTGCAATAGCACTAAGCACTTGAGGGC
CTATTGCCCTCTGCGCAAGAAGCGCGAGGCTCCGGCGAGCCAACCCTCCGGGTCATCGCCGGGAAACGGCAACTCCCAGTAGGCGCGGGGCGGCCTACTG
GGGAAGAACTGAGTTCTGTTGTGCCTCGAAGAGGTAGAGGGCAACGGGGCTCAGCCCCGAAGAGAGCTGAGCTCTCTTACGAGAAGAGTGTGTGCAAGCC
GGGCTTGCTGGTCGTTCAAGCGAACGTGAAGGGCTTTGCAAAGGCATGGAGAGTCTTGATTGACTCGGGAGCCTCGGGCAACTACGCCCGTCGCTCCACC
CTGGAAGGGAGTCAGCTGTATGCTGAGGCACTGGAAGTGCCAACGAGAGATACGATCTCTGTCCGTCTCGCGACGGGGACACTGGTAACTGTGTCGAAGG
TCTCTGTCGACCTTGGAGTGAAGTTTGAGAACTTCGATAGCGTGGAACGCTGTTTGGTCTTAGACCTGGATGCGAGGTATGACCTCATCCTTGGCATGGC
ATGGCTGGAACGTCATGAGCCATGGATCGACTGGAAGTCGAAAACGCTGGGTGCGTCGCACCCTGCTCCTAGTGGAGCTTTGGTGAGTCATGAAACCACC
TCTGCTAGGAAGCAGAAGCGCTTCTGGCGCGAGCACGAGGCCGAGGCGGCCGTAGTGCTGGACATTGGTATGTCCGAAATTATTAGCAACGAGGTTGCTG
TTTGCCCTGAGGGCGTACGTCGTGCGGCATGTTATCCGCTGAGCGGTGCAGGTCAGGTCGATGACCAACTGCTGGGTGCTGGTGAGGACGAGCGCGGAGT
GGCGCGTAATCCACTGAGTGGTACGAATCTGGTCGATGACCTACCGCTGCGTGACCCGAGGGTCGCGGTCGACTGCGAGTCGAGGCATCATGGGCGTGGC
CCAGAAGATGCAGGTGAAGTGACACCTAGTTCACTGTGTGAAGGTCGAGGACCTCTCGGCTTTCAGCCGAGTGTCTTGCGAGACACTGTATCCTCTTCGA
GGAGTGATGGTGCTGCTGCACCCGGTGGTGGTGACGGAGATGTCACCACACCGCCCTCATCCGGCCGGGCTCGGTTGCGGAGGGAGAGGAGAAGAAGACG
CAGGGCGTCTGTGACGTCTTCGACGTCGGACGATGTGTCCAACGTGACGAGCGGTGATGCTCCACGTGATTGCTGTGAACAGCTGTATACACTCGTGAAC
GGAGTGACGGGGGAGGTAGAAGGCGATATCAGCCTTGATACTCTGCCCGCTGCAGATGCTCTGCTAGAGCTGGACGAGATGTCCATTGCCGAGTTCGGCG
AAGCCTTAAAGGCAGGCGAGCTAGCCGAGGTGGTCTTGCTGGGACCTGAGGAGGAGTTGAACTCCTCATCCGTCGTGGACGACGCGGTCCTAGAGGACAC
CAAGAAGGCGCTGAGCGCAAGAAGTGGATCGGCGATCCTCAAAGATCCTTCGGATCCCTTCTACCCGGTGGTGAAGGAGTATGGAGACGTTGTCTCAAAA
GACCCACCGACGGGCCTGCCTCCGGATCGAGGCGTGTGTCATGAGATTGACCTGGTTCCTGGAACCAAATACTGCGTAACAAGGCAATGGCCTTTGCCGA
GAGAGCAGTGTGACGTCATTGACGCATTCTTCCGTGCGAAGCACGAGGCAGGGATGGTGCGTGAGAGTAAGTCTCCGCACTCGACACCCACGTTCTGTGT
CAGAAAGCTGAACGGCAAGTGGCGCATTGTTCATGCTTTTAACAAGCTAAATGCGGCCACTATCCCGGCGCAAACGCCGATTCCTCGCAAGGATGTTCTG
CAGAACAACATGGTAGGCTGTACGCTGTACAGCGCGCTCGACTTGAATCTGGGGCAAGGTCTACTACACCTGGCTCAGGTAAACGAGCGAAATTCTCCTG
AAAAGGGGGGAAAAATCTCCGAGGGTTAGGCCCTGGGAAGGGGCTTGGGGAAGTCCCCCGGGGGCGTTTCCAAAAACCCCCCCCAAGTTTTAAACCTTCT
GTGAAGCCCATGTTTTAGTCCCACAGGCGTAGCTCAACTACTTGACATATATCGTCCATAGTCGTGCCGAGCACGAAAGTCAGACGTGGATAACCACATT
GACCACTTGCGAGCGGTGCTCGAGTGCATGCGCACTAATAAGTTATATGCCAACTTGGACAGTGCGTCTTTGGCGCGGAGGAGATACCTTTCCTCGGGTG
CTTCATTGGGAAGCGTGGCTTACGGGCAGATCCTGCCAAAGTCAAGGCCATCGTGGACTGGCCGGTTCCCAAGAACCAAAAAGACTTACGCAAGTGGCTA
GGCTTAGCCAATTACTTGCACAAGTACAGTGCGAACTACGCGGAGATGGCTCGGCCATTATCAGATCTCCTTAAGAAGGACGCACCATGGTGCTGGAACG
TCGAGCACGACGGATCCTTTGAGGCTGTGAAGGAGAGTCTCCTCCAGGCTCCGATCCTTGCGCTACCGGACCCGGATAGTCCGTTTAGCGTCGTCTGTGA
CGCCTCCGATTTTGCAATCGGTTGTGCTTTACTACAAGCAGACGCCGAAGGGCGTGAACGCGTGATCGCGTTTGAGTCTCGCCAGCTCAAAGCTGCAGAG
AAGAACTATCCAGTTCATGACAAAGAGCTACTTGCAATGAAGTATTCTCTAGTCAAATTCAGGGTACACCTGCTAGGCTCTAAGCCTTTTGTGATCTTTA
CTGATCATGCGTCGTTACGCACTGCGACACAGTCGCCTCATCTCTCTCAGAGAATGGCAAGATAGCTTTCCTTCTTTGCCGAGTATAACTTCGAGGTGAA
GTACAAGCCTGGGCGCCTTAATGTAGTGGCCGATGCGCTCTCGCGCAGGCCGGACTACGAGTTAGCTCATGTCACGACAGTGACGTCGTCAGTGCCTGAC
TTGATACGCGGAGCGTAT