Description :
From Genome Similarity Track
Location :
Scaffold_168:50777- 56143
Sequence
5366 bases(100 bases per row)
CCCGTTACACCTGGTAGTACTTCGTAGTCCGTTCAACGACCATGAACATGTTGGACGATGAGGGGGATGATTTTCATCCCACGCATGAAAGCTACTCCCA
TTTGAGTCAAATCGAATGGGACGCTGTTGAACGCTTGAGTTCAACGATAGGGCAAGAAGCCGTTGGCGCACTGGTGTCCGCCCCGGGGACAGACGGACAG
CAATCTACCATCGCCAAGTTCATTCAGAATGAACTTGACGCAGAGCTGGAAAAAGTAACCTTGCTTCACCAACAAGGTTCTTAACAGACAGAGCTGTTGA
GATAACATAGTGCTCAACAGTTTAAACTGTTGAGACAGCAGCAGGCCACTGCTACCGAGTCGACGTGTATATGTCGACCCGAGACTCTAAAGATTGACAT
CTCAAAGTACAAGGGAGCCGATGAAGACTCTCTGTTGAGATGATTCGTGGAACTAGACGATGCCATAAGGGCTCGTCATATCGTCGATGAGGAAATGCAG
ATCGCATTTGCTCAATCGAACTTGGCAGGGCGTGCAAAGACGTGGGGCTTAAGTTACACGACCCATATGTCGTTGGGTCGTTGGAAGTCTTCAAGTCCCT
GCTAAGGCAAACTTTTGAGCCTCCACGAGCGGAGTTCAGGGCTTGCTCTGAACTCCTGAGAATCAAGCAAGGTAAACGTGAAGTACACTCGTATATTCAG
TACATACGTCACCTTACCAGTTGCATAACAGTCGACCCACTGAATCAACAAACGTTGATTACGTTATTCATGCAGGGTCTGACTGATGGTCCTGTTAAAA
CCTACCTGTTCCGGTTGGAGTTCAACACCCTGGAAGAGGTGAAAGGGGTGCGGAACAGGAAGACTTCAGCGTGAAAAAGGCTCACGCGAATTCGAATCCT
ATCGTCCGTCGAGAAGACAAGAAAATGGAGGCCCCAAACCTCTGTCACGCGGGGAGCGAGAGCTCTCGTGTTAACAACTACAAGAAATTGCAAAAATGCA
ATAGATGTCAGAAGACAGGGCATTACGCATATGAGTGCAGTGCCCCGAGCGCGGTATCACGTACCGCAGGGAACAGTAACCGCCAAGCGGCCAAGCGGGA
TCCAAGGCGTGGGTCCGACGTTGTTGTGAAAACGCAACAAAGTAATGGACAGCCAAAAAATGGTCAGGGTCAGTAGGTGCAGAGCACCCTACTGATCCAG
CAACGTCTATTGAGTTTGCAGGCCTATTGACGAAAGCTGCTTCCAACACTCAGTCATTGTGTGTTGCTGCCTCTGGTAATGAGGTTTCCCTCATTACCTT
GAAACTCGAAGCGACACAAGGCATGTCGCTTCGAGCTCTAGTCGATAGTGGCGCGTCGAACAATTTGTACGACGACAATCGCTAGACAAAAGAGAGCTCG
AATATGTTGAGCGAGAGGTCCCTCTAACGAGGATGACGGTGCGCCTCGCGACAGGCTCATCCGTAACAGTGATGAAACGTGTAGTGGGTATTACCTTTAC
ACTGAAGGGAGTCCAATACGATGATGACTTCATCATATTAGACTTGGATGACAAATTTGATGTCATCCTTGGACTGCCGTGGCTCAGAAAGTACGAGCCA
CAAGTCAGCTGGCATAGACGAACAGTCTATATTCCTGTCACTTGTTCATCAGATGGCCATCTGATGAACGCCATGGAGCGCCCACTAACATGTGGGTGTA
CTACGAGCGAGTGCGATGGCCTCGCGTGTGGTTCGGTCGTTAGTACGACTGCACATGGTCATGGAGTGGCTGATCGCCACACCATGAAGTCAGATTCCGG
CGACTGCATTGAGATGCAGGTCGCATCGAAGGCCCACCACCCGAATAAGTCGAGTGGGCATGGGTATCCTCCAAACGGACAACACCCCAAGTGAAAATGA
ACCGATTGCCAATAATTGGCAATAGGATGATCTTAGTGCGATTGGAGAATCGCACGTAGAAGATCTGGTCGTGGTAGCGCAACCACCGCCAGAGGATAAC
GAGGGAGAAATTCCACTCGTGTCAGATGATGAGATAGCCAAAGAGGTTAGTGAGGGAATAAGTCCCCACCCAACTGTGGAAATAAGTTCCCAAGAGACAA
CATAGACATTAAATATCCTAGTCAATGACGGATCAAGCATAGGAACATACCAACTTGATCTGATCGCGCATCCGAAGACAACTTCGGAGATCATTCAATT
TCCCACGCTCGAACAGAAAAGGTTCTTGCGTGATCTGCGTAGTGGCAAAGTCAAGCAGATTTGCGTACTCGTCGCGGAAGACGAGTATGTAACCGATATT
CGGTCGGCAATGGTATTCGCTGAGAACGAAAGGGTTCTCAGCAGCTCATTAATGGAAGAGAGTGTCCTTGATGAGAAGACTCGGATTGAGCGATACACAT
CCCAATCGTGGGAATCGCTCAAGACAAATCATCTCTACGATGATTCGATGGAATTCAGGGATGTGTTCCCAGAAACAGTGCCGTGCGAGCTACCCAAGGA
TAAGGGTACTCGTCACGAGATAGACCTGAAACCAGGGTCAAAGTACTGTGTCATGAAGCAACGGCCATTGCCTCGTGAACAAGTACTAGTGATTGACAAA
TTCTTTGCCGATCGCTTGGCAGCGGGCCATGTGAGGGAATCTATTTCCCCACATAGCTCTCCGACCTTCTGTGTCCGAAAGTCCACAGGAGGATGGCGGA
TAGTACATGCCTTCAACAATTTGAATGCTGCAACTGTACCGGCTCAAACGCCGATACCAAGAAAGGATGTCATTAAAATTAGAGATGGTAGGGCAAGGAG
TACCATCTTTTCATCGATGAATCTGATGGACGGGTTCTATCAGATCCTTATGCGTGAAAAAGTACATTCGGTACACAGCAGTGAGCACCCCGAGCGGTAT
GCTTTGGGAGTGGCTAGTAATGCCACAAGGGCTGAGTAACGCCACTGCTACGTTCAAAAGATGCGTTACGAATCTGTTGAGATCTGTGCGAGAATTCGCA
CCTAGCTATTTCGATGACGTGTTCGTCCATAGCCGGGCTATGGATGAACAGACGGATTTGGAAGTCCACCGACTCCACGTCCGAAAGTTTCTTACACTGA
TGCGTGAGCGTAAGTTTGTACGCCAACCTCAAGAAGTGCATATTTGCTGCTAGCGAAATACCACTTCTTGGATGCATCGTGGGTAAGGACGGCGTCCGGC
CCGATCCGGAAAAGATCAAGGCGATCACTGACTAGCCGGTGCCTACCGACATAAAAGGACGTCGAAAGTTCCTTGGCCTTGCGGCATATTTGCACAAATA
CTCGCACAATTACGCCGAGATGACTGTTCATCTCTCTCGTTTATTGAAAAAGAACGAGAAGTGGGCATGGAGTGCTGATTGTCAGCGCTCATTCGAAGGT
ATCAAACAAAGCTTAATACGTTCGCCAGTTTTGGCAATTGCAGACCTAGACAGACCATTTCATTTGGTCTGCGATGCAAGTGATTTTTCCATCGGATGTG
CACTAATTCAGTATGACACAGACGGTGCTGAGCGTGTCGTCTGCTATCAGTCACGTCAGCTGAAACAGACTGAGCGCAACTACCCGGTCCATCACTAGGA
ACTCCTTGCCATGAAGTATGCTTTGGAGAAGTTCAGGGTCTACCTGCTAGGAGATAGACCCTTCATCGTTTACACGGACCATGCATCCTGACGCACGGCC
GTTAGCAGTCCACACCTCTCGCAACGAATGGCGAGGTGGCTGTCGTTCTTCGCGGAGTATAACTTTTCTGTGGAATATAAATCAGGACGACTGAATGTCG
TCGCTGATGCTCTGTCGCGCCGGCCCGATTTCGAACCGGCTGCGCAACCCGACACTGGTCCAACCACTGTCGCGGTGTTGACGTCGAGTGTCCCGTCGTC
AACCTTATTCGAAGACATACGCAAGGCGTACAATCCGGCGATGGTGCGTTTGATGGATCATCTCTCGCAACCATCCCGTCAACCCCTTAAAGGGTTTCCC
CCAGTATATCGATCCTCCACGGACAGATAAAAATTCCACATTGACTTACTGAAGGATTCAGCCGTTGCCGGCGACACACCTCTTGTCGTCGTACCGGACC
ATGGTGATCTGCGACTGCGCATCATGTATGAGTACGAAGATGCACCTACTGGTGGGCATCGTGGTCGAGAGAAGACATATCTCACAGTTAGTCGCGACTT
TTACTGGCCCCGCCAGTATCAGTTCGTTCGTAAGTACATCCGCTCTTGCGAAGTATGTCAACTAGTGAAGTCTGGTCCTTCACTTCGTGCGCCGTTGCAC
CCTTGATCATTCCGGCAGAATGCTGGGAATCAGTCTCAATGGAATTTGTCTTTGGATTCCCCGCAGACCCACACAAGAATACCGGTATTCTGGTGTTCGT
TGATAGATTCAGTAAAATGGTACACCTTTTCGCTGTACCTGAATCTATCAATGCATCGGCCTGTGCTCGTGTTTTTATCGACAAGATCTTTCGTCTTCAT
GGGTTGCCTCGTGAACTCGACTCCGATAGATACCCACGGTTCACTGTTGAATTCTGGCGATCCGTGTTCAAAACACTCGGAACGCGCCTACAGATGTCGA
CTCCTGACCACCCTGAAACAGATGGTCAGACGGAACGCGCCAACCGGGTGTTCTTAAAGAGATCCTTCGAGATTATGTCCATTCGTTTACGAATTGGAGC
GAATTCTTGCCAATGGTGGAATTCGCCATCAACAACTCGGTGCATGCATCGACGACGCATACACCGTTCTTCATGAATGGCTTGCGCCACACACGCCTAC
CTACCTTTTTAGAGTGTAACTCTAGTTTGAGGGGGGAGGGAATCATTCAAGCGAACGCCAACTCGGCTCTCACTCATCACGTACTGACCACGAGGTCACT
ATGTATGACGCCGATGTCGATCACATCGACTTCGGTGAAGAAGAGGAAAGTAAGAGCGAGGATGCTCTTACTACCCAGGTCCCTGATCTTGCCGCAGTGC
GCTCCAAGCGCACTGTAGCCAAAGACATCGAGTCATCAGATGAATTCATACTGGCTCGCGTAACGGTTGTCTGTTTCGTGCAAGATTCCATTGCAGAAGC
AGTGGACCGACAAAAGAAAAACGCTGACAAGAATGAAAGAGCAAACGTTTTTTTCATTCAAGTAAGGTGACCTAGTCCTACTATCTCCGGTAAACCTACC
TCGACACATAGTGACTAACGTGGGTAGTAACAAGTTACTACCCAAGTTCATCGGTCCATTTCGTGTGCTGCGCCGCTTAGGCAACGCGTACACGATTGAA
CTGCCACGCAAGATGTGCATGCATCCTATGTTCTACGTTGGTCGCCTTAGGCCGTATCAACAGTAC