Description :
From Genome Similarity Track
Location :
scaffold_86:50769- 65813
Transcript NameFunction/comments
g3140.t1 putative RNA helicase
g3141.t1 hypothetical protein PHYSODRAFT_538135
g3142.t1 predicted protein putative
g3143.t1 conserved hypothetical protein
g3144.t1 hypothetical protein PHYSODRAFT_284561
g3145.t1 hypothetical protein PHYSODRAFT_358780
g3146.t1 hypothetical protein PHYSODRAFT_310097

Sequence
15044 bases(100 bases per row)
TTTTATTGCACGTTACTTTAAAACGGAGAGCGAGGCAGCGCTGATTCCTCGCCAGTCCACGTGGGACACCCTCTTCCTGATAGTCACCACTGCAGTTACA
GAGGATACGCCACGCTTTGGACGTCTACCAACGACCGCGGCCGCCACCGTAGCCACCACGGCCACGGCCACCACCACCGCCACGACCCACCAGGTCGCGC
AGCTCACGAGGTACTTCTTGTTCGGCTTCCTCCATGATCTTCACCAGAGGTCCAGCCAGTCGACTGTTGTTACCAGCGGTGAAGAAAGAAATGGACGTAC
CCTTGTTACCAGCACGGGCCGTACGACCGATGCGGTGAATGTAGTCCTCAATATTCTTCGGCATGTCAAAGTTCACCACGTAGCGAATGTCCTTGATATC
CAAACCACGTGAAGCAACATCAGTGGCAACCAAGATCTGCGTCCTGCCGTCCTTGAACTCGCGCAAAACGTAGTCACGCTCCTCCTGCGACTTGTTACCG
TGAATGGCCTTGCACATGTAGCGGGTGTTGCGCAAGTTGCGACTCAGCTCATCAGCGCCACGCTTAGTCTCACAGAAAATGATAATACGGCCGCCTTCGT
AGATGTCACGCAAGTGGTCCTGCAGCGCAGAGTATTTCTGGTGGTCATCCATCACCTCCACAATCTGCTTAATCCGCTTGTTAGCAGTCAGGTCCAGGGA
GCCCACTGTCACCTGGATAAAGTCCGTCAAGAAGTCGTTGGCGAGGGTCACGATCTCCTTCGGCCACGTCGCCGACCACATCAGAGTCTGACGGTCAGGG
CGGATCTGGCTCACGATCTTGCGCAATTGAGGCTCGAAACCCATATCCAGCATGCGATCAGCTTCATCCAACACCAGATAGGTCACACGGCGCAAGTTCG
TTTTGCCCATGCTCAGCATGTCAATCATACGGCCAGGCGTGCAAATGCAGATTTCCACACCGCGACGAAGGTCAGCGATCTGGCCGCCTTTAGGGACACC
ACCGTACACGCACGTGTTCTTGATCTTCGAACTAGCACCGAACTTGTTGCACTCTGCTTGGATCTGCACGGCAAGCTCACGCGTCGGCGCAATCATCAGC
ACAATCGGTCCGTCGCCAGGCTGAAGGTAAGGCTACATTATTCACAACACAAAAATAAAATGTTAGCGTCGTAATAACACCACGAGGCAAGCAGGGTTGC
ACAAGAAAGCAAACACAAGCGAGCGCCGAGGGATTTATAGGTGTTCGCATGCTGCTTTTTCTTCTGGCCATCGCCCACAACGCACCAATGCAGTTTTCGC
ACCGATCGATCGTCAGCGAGAGAAGAAAAAGCCATCTGAAAGTGTGTCGGTTGTGCCGGACCAAACTGTCGAAGTAAGTCGGTGGTTCCTCTTTCCTTCA
CATGCGTGTTGCCATGCATTATTGTCCAGAAAGAGGCTGGTTTCACCAACTCGACCGGCACTCGAACACAGCAGACTGCAACCCGAATCAACCGAAGTGA
CGAATGACACGTAAATGGCGCTAATGGAGACAGTACCCCACAAACGCGCATCTACGTGAATCGACCACGCTCTGAAGACCGTTGTAAACCCCACGCCTCA
CGCGTGTGCGTCTCGTTCAGCGCATCACAAAAATTGTGCGTGAACGAACATTGTGTGATCAACACAACTTTGCAATCAACCTCCATCAGCGCGCCAACGC
TGCGGAAGATGTGTCCACCAACGAAAAAAATCCCCTCAAGAGAGTCTGCTGCAAAATACGAACCTGTGCGTTAATGTGCACGATCGCAGGTAGCAAGAAA
GCCAGAGTCTTGCCCGAACCCGTCGCTGAAATTCCCACCATGTCACGTCCCGAAAGAGCCATCGGCCAGCCCTGGCACTGGATAGGCGTAGGCTTGTCAA
AGCCAAGACGCACCACCTCCTCCAGCACATACTCCGGGAAAGAAGCCTCCTCGAACGACAAAACGCACTTAGGCACTCCCTTTCCGGACACGATAATCTG
GTTTTCGCGCTTCCACTGCTCGTACTCCTCCTCCGAGCGCTTGCTCACGTCCGGGTGCTCGTAGTAGAAGTTCTTTTCAAAAACGGGCAGCTTTGAGAGG
TCCCATTGAATGTGCGTGTCCAGGTTGGATCCCAAGTCGCCGCCGCCTCCGAAACCGCCGCCGCCACCGCCACGGCCTCCTCCGCCGTAGCCGCCACCAC
CTCCGTAGCCGCCACCTCCACCTCCGCCGTAGCCGCCACCTCCGTAGCCGCCTCCGCCGCCACTGTAGCCGCCGCCTCCACCGCGAGAGCCTCCGCCGTA
GCCTCCGCCGCTGCTTCCGCCGTAATCACGACGCGAGGAAGAGTCGCCGTATCGGTCACCGCCACTGCCGTACATGATCAAGAGTGATGGTCCTTGGGTC
GCTTGCGCACTGCAGGTCGTTTCAGCGAATGGTGACTGAGTGCAGCATGGGCGACAGGGGCAGAGAAGCGATCGCTTTGGACAGGGAACGTTAAACAGGC
GCTTTTGGTTGGCTGCCGGGACAGCAGAATTTCAAGCAATCATATTGAGGATTCGATGCTGAGGACGTTGATTGGGTGAAATACAAGAACATGAAGTCGC
CAACAGGCAAATTTGGATCGGTGCATGAGCCCGTTGTATTGTGCACTGCCTGGCGACAGCGCAGATGACGTAGGACGGGGTCTTTGCCTCTCTCCGCAGT
GGATGGTTTGGTGATTCTGTGGCCAAAAAGGCTGGGTGGGATCCCGTTCAATAAAAGCCTTTACGCGAGAATGGAGCGCTCGTACGAGGCAAACTGCTGG
TTGGCCTCTGAGATGCTCACTTCGATTTTCCGCACGCCGCGCTCCTGCAATTGTAAAACGCTGGAGTTAATAGACAGAACTCTAGCCATGATGATGTGTG
GGCATCGCTTTTCTTACCAGTAGCGCAACGAGAGTGAAGGAGTCAATAAGCTGGTTGCTCTGTAAACGGGGAGAAGTAAGCGGCGTCAGCATCGACATCG
TACAAACAATGAAGTAATTGCAGGCACGTACGATGTAAATGGCCAGCTCCTCGGCCGATGAGTGCACGATGGGGAGTAGTGAGCAGTCCGCCTTGGGGAA
GCTGAACTTCGCCATATCTTCCGTCAGAATATGAACATTCGTGCCATCAAACGAAATCTGTGTTCAACGCATACCAAGTCAGTACCCTACGGCAATTAGC
GGCCATCACGTGCTCCCGTACCTTCAGAGAATCGCTGTTCATCGGCACCAGGAACGATTCATTCAGATCTTTGCAAATGACCCGCGAGATCTTCTTGATT
TCACCAAAGTCCACCACGTATCCATCCGGGCCAACCTGCCCGGTGATCGTGACGGCCAAGCGGTAGTTATGGCCGTGGAGCTTCTCGCGGAATCCCTACG
TGCATGCAAGCGTTAAACACCCCAGCCACTACAGTCTCCACATTCAATAATGATGCGTACCTTGTACGCAATGAAGTGGGCAGCGTTAAACTTCATATAA
TCCTTGGACACGTGCACCTTGAACACCTCGTTGTAGCCGTTACTCATACGGTTGGGTGTGGGCACTCCGTGTGTTACCGGAGCTGGCACTGCTACCACAG
TTGCTGCTGCTGCTGCAGGGGCCGCATTAACCTCTACAGAACTGCCGGGCTCGTCCGGCTTCGACGCTGTCTGCACCGCTTTGGCGGGCGAGGTGCCGCT
GGTTCGGAACGGCTGAATCTTCATCTTAATCTCTTCTGGAGTCTTGACACATCCGCGCAGGTGCGACGCCCAACGGTCCACGTTGCGAGACGTGATCTCC
TTTTCACAGTAACAGCACTTGACTGAGTCGGAGCTGCGCGACACGTACATCTTGACGATGGCCTTCTGCTCAGCGGAGAGTTCCTTGGCCATGGTAGATC
CAGGGGAGTTGCGTCTACGTCTCTTGGTCTCCGGTGTGGCCTGCTGCTCGCTGATCCTCTTGTGTTCCTCGTCAACTGACAGCATCGGGCCAGGCGGCCA
AGAGCTACTGGACGCTCTCCGCCGACATGAAAAACGATGCTGAAGCGGTTTTGATTGGCAGAAAGGAATGTATGGTGTATGTTACACAATCTCAAAGATT
GAAAAGGCGAAACAATGACACTCGAGGAGCGGAAATATATAAGGAAGCGTGCCAGCAATTTCAAGCAGTGCTTCACTTGCACGCAACTTGTGTGGCACGC
TGGCGACGACGCCCTATTGGTCTGAGACAGCACGCGGCACCACACTGAGGAAGAAGTTCATGCTCACGCCGAGCAGCAGGCCAACTTTCTGCTTGCGAGG
GACGGAGCGGTCGAGAAGCTGGTGTAAAGAGGGATCATATCGACGAGTTAGAAGCAAACCTAAAGGCGTTATCAGCAGTTGAAGAGAGGCACTCACCATC
AGAAGCATAAATACACCAAGCAGGAGGCCCATTAGGAACCCCCAGAGAAATTCAGTGCCAGTGCCTTCATTATCAGCTGCGAGAATCGAGTTGTTCATGC
CGTTCATGTCGATTTGCGTGTCCATCGCAACGCGTGCCGTTGGAACAACATTGAGCGCTGCAAAAAGCAATCGCACAAGCAGACACGTTAGTAATTCTGA
ACATACCAAAAGCGAAATCCCTCGAACAAGTTCATACCAAACTCGGACTGCGGGCCTTGTGACGCCATCCACTCCTCCTCCAGTCGGTATATCCGGTCTT
CACTGCTTTCCCCGGGAACGCGTTCCGCCTGGCTGATATACACCGAGAGCTGCGGGTAGAAATACAGACGCAGCGCCTGGATCTCCTCCCGACTTAACCG
GTCGCGGAGCCTATCGAAGCCTCTCCTCGCGGCTGGGTCATCTCTCTCCTCTGGTTCACTCTCTGTAGCTGTCATCTACAGAACATGAAGTACACCGTTA
AGCATTGCGAAATTAAATGTCTCCACCGAAATAACAACAGTTCATCTCACCTGGTTGACCACGGCTTTGGGCGGTGCCGAGCTGATGGCGCAATGGATAA
AGTCCTCATTCTTGACCTTGCAGCTCGCGAGTGTTGCCTTGTCGTCCGACAGCATTTTGCCCTGGTGAATAAGCCGCAGAAACTTGCCCTCTGCATTGGC
TTTCTTCTTCACGAGATCCTTGAGCTCCCCCACACTGGCCGAGGGCGTGATCTCCACACGGAGCGGCTTCTCACTGAGGGTTTTGACCTTCAGCACGATC
TTGCCATTGTTGTCTTCATTGATCGTGATGCCCACGGAATCTTCTGACAACTAAAATAAAAAACAAATATTCGGATTAAAATTCGCTAATTTCTTTAACA
AAAAACGCGTAGACAGCAGAACATCTACCAGTGGCTTCTCCTCCGTGATGTTCTCGGTGTGCTCAGGCTCCATCATGCTGCTCAGGTCGATCGATAGGGC
GTCTACACGCCTCCTCGACCGCTCAGCGCCCTCTTCCTCTGCGCTGCTTTTTAGCTGTGCCGGTTTTTATTCTCGCCCGCGGCTAGGGATGGGTTGCTCG
AGCCAGTTGGATCTCTATTCTACGATTGGAGGAAAAGATTGATTCAGTTTTAGCCAATCCCACGTGTCAAAGCTATTGCCCGCCAATTTCAAACAGCTTG
TGTCAATGGAGAGCAACGTGCAGGTGGCTGTGCGCGTGCGGCCATTGAGTGCCAGCGAGACGGATCAAGGCTCGGAGGCGTGCGTAGATGTGGTGGATTC
CAGTGTTTTATTGGCTGAGAAGCAGTTCGACTTCGAGGCGGCGTTTCCAGCCACAACGCAGCAGGTGCAGCGTCAGCAAATTGGATTGTGTGTAGCGCAA
ACCATTCATTTTTTATTGTTCGTTGCAATTGCTGTAGAAAAATGTATACACTACGTTGGTGGCGCCGATGCTTGAACAGTTCTTTGATGGCTACAACGCC
ACGGTGTTCGCCTATGGACAGACGGGATCCGGCAAAACGTGAGTACACTGAGGGGTGTGTTAGATTTATTGCTGCTTCGCTAATATGATTGACGTTGCAG
ATATACAATGGGCAATGAGTTCGCGTCCAATGTCACCCCGACTGAGCTCGGTGTCATTCCACGCGTTATTGAAAATGTAATGTTGCTGATGGTTATGATA
CTGTTGTGTGGGTGTCGAGGTTGAAGTTGACAGATCTTGATATACGTGTGCAGATTTTTAAGCGGGTTAGTGCATCTTCAACCCCGCAGAATTTCGTGAT
TAAGTTGTCCTACTTAGAGGTACGTTGCTATTGATCGTGATGTGACTCCTTGACGCTGATTCAACTCTGGCCGCAGATCCTGAACGAAGAAATTCACGAC
CTACTAGCAAAAGCATTGCCTGGATCGCTGCAGGTCAGCACGGGGCTATCTATACGTGGCGATGGAGATCGTGGAATTGTTGTGGCTGGACTTAGTGAGC
ACATTGTGAATTCGACGGACCAAGCTGGCGAACTCTTGCGCGCTGGAGCCTTGGCACGTGCCACAGCTTCGACTAGCATGAACTCTCAGTCCAGTCGCTC
GCACGCTATTTGTACCATTGTCATGGAGCATCATGACGTCCAAGCTGCAGAAGGAGGCACGGAAACGCGGTTTTCAAAGTTTCATTTGGTGGATTTGGCC
GGGTCTGAACGCGTCCGACGCACCAACTCGGAAGGAGCACGCTTTAAGGAGGGTGTCAACATTAATCGCGGGTTGCTCGCGCTCGGGAATGTTATCAACG
CGTTGTGTGAACGCCGCCGCACCAGTTCGTCGACAGCTCATATACCCTACCGAGACTCAAAGTTGACGCGTTTGCTCCAGGATAGTCTGGGTGGGAACAG
TAAGACGCTGATGATCGCGTGCATCAGTCCGGCTGACGTCAACTATGAGGAGACCTCAAACACACTGCGGTATGCATCTCGAACACGGAAGATTGAGAAC
CAGGCAGTGATTAACAAGGAACGAAGCGCTGAGAACGAGGTGATTTACTTAAAACAACAAGTTGAGATCCTACAACTGCAAATCCTTCAGCACACACAAG
GCATGACAAGTGGCCTAAGTAGTATGGATGGTCATCGCCCAAATAATCTGGAAGAGGAGAATCGCAGGCTTAAAGAAGAGCTTTTCATCGCGAACGGTGC
CACGGACAAGTGGAAAAAGGTGGAAAATGAGCTTGCGGACATGAACAAGAACGTGAATGGAGAGGCAAAGATGTTGTTGGACAAACCGACTCAAAAATCG
AAGCCAAAACCTAATAAGAACGGTAAGGGCGACAGAGGTCTATCGCGTTTGGAGCAACTTAGGAAGTTTCAAAGCCAGAAATTGAAATCAGGCAGCACGA
AGGCAAGTCCTGCTGTGAAGCGGCGAACTGATGGCACCACGTTACCAAGCAAGCGCAGCCGGACGTTAATATCACCAAGTACTCCAGACATTGGGAGAAA
AAGCTTGAGCGCGAGGACGCCAGATACTAAAGGCACAGTTGGTGGGCCAGACACTTTCTCCATTGGTGCCACGACAAAGCTGTTGCAACGGGTAATGGCG
TCTCGGGAGGCAGTTTCTAGTGCGAAGGAGGCGGTCCGGACCAACGTTGCAGATAGGAAAGCTTTGGCGCTGGAGATTTCACGGTTAGAGACTTTGCCGG
CGGTTGAAAATGCTGAGAAGCTGGCCACGTTGCGGGATGAACTTCGTAAAAAGACGGGTAGCATCCGTATTCTGCAGCAGAAATTGGCCAGCATCGAGGA
AATGATGTCACCACCCTCGGGACTCTTTCCTGCAAAGGTTAATGTCTGCCATGATCTGATTCGGCATTTGATACAAACACTGGTGGAAAGCAAGGAAGAG
TGTACGAACTGCAGCGTGGAGCTAAACGCCGCCAATGAGGAGGTCAAGAGACTGACAAAGGAGTTGCAGAAGCAAGCAACGAAGAGGAAAACAGCTAAGA
AGCGGAAACAACGGCAGTCGTATGAAACTATGGAGACGCTGTTCAGCAGTAGCGACGATGAAGACGATAACAGCGCAGACTCGGATTATGTGGATGATGA
GGACCGTCGTGCGAGAAGAACCAAGAGAAAAAGAGGCACCAACACCCCATCGAACGTGACGAAAAGTGCGGATGTTATGGATGAAATCAACGAGTTGCTG
GAAACCAGTGCCGCTTCCTGCTGCTCTTGTCACGGCAAATGTGCAACGAAGGCATGCGCTTGCAAGGCGCAAAGTCGAGTCTGTAGCGACAAGTGCTCGT
GCAATTCAAAGAAATGCCATAATCAAAGGAGTGAGGATTCCCCCAGTGCTCATGGCGATTCTCCAAGTGAAAGCCTGAAAAATAGCAAAACAAGTGAAAT
GGACAATTCAGCTCCAAATGGAGTTGAATCGCCGAACTTGACTGCCACCGAACCTTTTGGTACGACAGCTGCGACTGAATTGCTGTCACCTTGATCGTAC
GATGCTAAGGTCAAACTTAACGAGGTTTTAAATCATGTATTTAGCTTTTACCGCATCGGATGAGCACTTTGTTTACTTGACAGACAAGCTGGTGCTTTAT
GATAAGTCCTCAAAGAGGTCCATGTCTAAAGCTTCCGTTTTCTCCGTCGTGAAGTCGGTGTCGTCCTCGTCGTCCGTGTCGGAGGAGGCATGGTGACGCG
CCGCGGCCTTTTCAGCACGACGAGTTGGTGTGCGGATGCTGACACCGTTCGAGTTTTTGCCGTTGCTGCTCCCGACGCTTCCAGTTTCCTTGTGCTCACT
CGTCCTTGATCTCGTTCGGATGACCAGTGCGGCTTCCTTGGGCTTCTGGTACTGGTAAGTGTTACTGTTACTGGATGAGTATTTCGCACGCAGCGCTCGG
GTCTTCTCTTCACTCTTCTTGGCCAAGAAGCCCTGGATCAGCTGGCGCTCGTGGTTGTTCATGTACGCCAGTTGCACACTCGTGTCAATGACCAGGAAAA
GCTCCTGGTATTCAGATTCCTGGCGTGTGAAAGCAGAAGCGGGCGAGAAAGCATAAGAAACCACTTCGAGGATATCGATCGAGTCGCGATGATACGGAAT
TCGCGCGAAGGCCAAACGCTCTGCGGGAATCGATAAAGCAGCACTGGCAGCATCCGCCAGATAGGTATCGGGGTGTTTTTCTTCCTCCAAAGTGGAAATG
ATCACCTCATGCCGCATGTTCTTGACAAAACGCCACGTCGCACGGTTTACATAGGCGAATTCAACAATTCGGTGGTTAACCTCAGACGTTTCGGGTTCGG
CCAAGAGCTCAGCCACAATGCTCCTTCCTTCATACACAGCCAGCTTGGATGCTTCCACGAGCTTTTGCCCATCCACCAGCACGCTGGTCATCGTACTTTG
GCGCAAATCACGCAAGCGGATGTGAGATGGAGTTACCTTTCCGCCTTCTGGCTGCACGAGCTGCTTCTCCACCAGCTCATCCCACACCTTCCTACGAATA
TCCTCCACCAGCATTTCTTCGCTGATGACCACTTGGCTCACGAATGTCAGCAACGAGTCGTCCTTTCCAGTTGACACTAACACCTCATCAATGTCAAAGT
TATCGTCTGCATTCGTCACAGTAGGCTGGTCCTGGTTGCTTCTGTCATCGTTCTCTGGAGAATCCGAATCAGCCTTTGTCGGGTTATAGAACATCAGGCG
GAAGTTGTACTCGCCAGTGTTCAACGGTGTCCCCTCCAGAGCGAAGACCGTGTGGTTCGAGCCAATCGATAGTTTCGATAGAGTGCTGTCTATCGCCTTG
ATTTCCACGCCGGCACTGTTAATGCCACGCAACAGCTTGAATTTGTTAGACGGGAGACCAATCCTGGCACTAACCTGCTCCTTTAGTGTGCGGATCGTCT
CCCTCCGGTCAATGCGAATAGGCTCCGCTGGGCTGGTCAGATACTTAAAGTTTACTGTGATCATGTTCGCCTCACGCTCGAAAAACGCCTCAGCCGGTGA
AGGAAGTGCCAGATCAGCAGTTTCCTCGAAATACAGCTCCGTTCCATTCACCAGGTGTAGATCCATCTTCAGCCGCAGATTCAGCGTCCGTTCCTCTTCG
TTTGAATTGAGAATCTTGGCCGCAGCTATGCTGTATGTGGTTGCGCTCTTCTTAATGAGGCGAATCTTATAACCAGCCCTAACCGAGAACTTCTTCGCGA
TCACAGCGCACAGCAATGCAACATTCGCATCGTCATCCACCTGGACGCACCTCGCCACGAACGAGTTTTGACTGGTGCTGTCTGCCTCTGGGTCGACAAA
GCGACGGATGAAAAGCTGCAATTTTGTCGGATCATGCTCTTCCCACTCTTCGTCGGTACTTTTAACCTCGAGGAACATCTGGTGACCACCGTAAACTCCC
AGCGACAAGAGAGTCATATCCTCCTTGTCGGTGTAAGTGTCGGATAGCAGGCAGTTGTAATCATTGTAGCCTCGCAGTCTCACGTTCTCTATCGACGGGA
TTATGACATCCTTCTCCTTCGCGAATTCCTTGTAGGCTGTTTCGAGTGCTTCCCGGATAGTTGCAGTTTTGTAGATGTGGATAGCCTTCTCTACGTTTTT
CGGCTTGGATCCCTTCATGAAGAACTTCAGCTGCACCTTCTTTGCCATCTCAATTCGTTCCTGTTCCAACCTACGAATCTTTTCCTCGTCAGCGTGGATC
CTGTCTTTCAAATACTGCGGAATGCTCTCCGGCAAGATCACGTTAACATTCTTGTCAGCGTTAACCAAACGATACAACAGCATGTACGCGCAAGTGCTGT
AGCGCATGCTGTATCCAGAACCACTTGCACCTCCGAATGCAGTCTTCAGTTCGGTGTCTGAAATCTCGCTCACAGTGGAGTCGTTAAAGTTGTACCATTT
GCCAGACTCTAGAGATTTAATGTACGCGTAGTAGTGGCCACCCAGCGCACTGCCAGAATGGATCAAAACCGAGTACAGCTCGTACACGTGGGGCCCCGAC
CGCTTGATCATGACTTCCGGGTCGAAAGTTGGGCTCCACGTGTCAAAGGTAGTGGTTCCGTCTACGTCGTCTTCATCATCGTCCTCCTTTTCATCATCTT
TCTCAAACGTCACAGGCTGTGACTCGTCCATGGAGGACAAGCGACGCATACGCTCACCCATAGCGGCAAGCCCTGGCGCCGGAGGAGGCGAAGCAGGTGT
AGCTGGCACTGTATCCTCTTGCGAGATGTGATGGTTCTTACCTTCCAGTACGTGACGCTCCATTGACATTTTTCTTGCGATCTTACCACGAACGCCGCCA
TTTTCATCACTTAAGTACGAGTTCATGTCCAGATACTTCGGGAACGTCACCTTATTGTGCAATTTGATGCGATTCATGGTGGCATAGTCAAAATCGAAGC
GTTTGAGCTGCAGCATCAAAATGTACGGCAGCTTGGAAAACTTGAGTCCCTTAATAGCGTCTCGTTTCACCTTACACTTGTCACACATCCACTGGTTCTC
CTTGTTAAGCACTTCCGGCCTCAAAAACAGCTCAATCGCCTCCTCCACCGTCTTCATCATCTCTGTGGAGCCAAAGGGGCGAATAACTAGCGATAAATCC
AGAAAATTGTCAATTCTCGAGCTTTCATAGCCACATTCACAGCACTGCACGTAATCCTTCAGTGATCCTTGGTACAAATCATTCACGAGCGTCTCGTTCA
CCGTGCCTTTAAAAGATTTCTCCAAAGCGTCCAGCAGAACTCTACAGAGCTCCTGAACATCATGTTGCTGGAACACGTCAGCTCCAGTCCATCCAAAGCT
CTTGGTCAGCGCTTTAGTGGAAATGGAGTCTTTTGTCGTCAGCTGCAGCTTGGCGAAGAGGTTTTGCAGTTGCAACGGGATATTATCTTCATCCGCCTCT
TCCTCCTCTTCTTCTTCTTTGTCCTCCAGCTCTTCTACCTTCTTAACAGGTCGATGACACGTCCAATTGTACAGTCCCTGGCGGAACTCAGGCGTCATGA
ACATGCTCTGCAGCAGACTGTTCATGTAGCACGTAGCTCCTTGATTGGACAGGCCCGTAAAGGCCTTTTTAGAGAAGCTGTAGCCCCCGGAGCTGCCGTA
GCTGCTGCCTCCATTGCTTGTGTATCCTGGAGAGTCGTAAATACCCTCCAGACCCGAAGAGCTGTACGTTGTAAGCGCTGTGGACTGCACACTGGGGCTT
GTGGCCGTTGGCGCACTGTCGTCCTCCTCCTGAGACGCGCGAGGCAACTGTGTTAGCACGTTCGCCACCTGCGCGCGGTGCTGGTCGCGAGAGGCCGAGA
GGTCGTCGTCATCGCTCGAGTCCCAGCCCGAGGGCGTCGCTAGATATTTATCTCCAGAACTTGACGCAGGCCAGTCGTTCGACTCCCAGTTCGAGACAGA
CGTTGAATCCGTACGATGAGGAACAGACGCAGACTGCCAGTCGCCGTCGTTTGAGTCTCTGGTCGAGGTCGCTGAAGCCTTGGGCGGATCTGTACGCCGT
GCCGCAGGTGCAGCCCTTCCTTCGCTCATACTTGATCACTAGAGGGAATTCTACCTATTGAGATCTAGAGACTGGGGAGGGTGGATGGTGTGGTGCACAT
CAAAAAATATAGGAAGTGATGGTCTTCCTAGAGTTCCAGGAGGGTTTTAATGTGCAAAACAGTTGTGGATTTAGATATCATCGCTGGGTGTGGGTGGGTC
TGAGAGTCTACACCATACGCGGCGTGGGGGACCTGTTCTTTGCGAGCGGCAGTTCCTCATCGGAGTCTTCAGAGCCGTAATAGGAACGGTCGCGCTTGAG
AGTGAAGGTGTCAGATAGGAAGTCCAGCTCACCCGAACGAAGCTTCTCTTTTCGCCACATTGTGTAGCAAAAAACCATCGCGACAGCGTACAGCATAGCT
AAAAGCGGAGAAAAATTGTCATTCAATTCATCAAGCAGAGGGCGCAGAGACAACAATAAAAATAACACACAGATTAGAAGCTGTACATCAATGAACCCAC
CCACTTGAATTGAATGCATGCTTCTCTGCTGTAGTGACGTACCTGCTTCAAAGCACGAGTTGGCGCCGGAATTGGGAGTCTTGGCGTTGAGGATGTACAT
CGGCTGCAGCTTCAGCAACGATCCCACAACTACCTGCAAATGTACACATAATAAATACCAAAAGCAATATTAGCAAGCGCAACATGTCGCCGCAGCGGGG
CGGTGGTCGACAGCGTCACATCAGCGTACCAGGAAGACGAACCCAACGAAGCTGAAGATGGTGCCGCATAAATAACCTTCAGGGAGCAAGTCGGACACCA
ATAGTCAGAAGAGAAGCAGGAGAATCAACCAAGCGCTTCGAACTGCGCTTTAGACTCATCGTAGCCACGTACCCCCTCCACTCATGCCGGTCTAATGTCC
GAGTTGCTGTGTCCTTCCTCGCCTGAATTGACGTCAATCCAGATGCTTCCGCCCCTAGAATTATTGACCAATCAGACGTAGTATCAGAGGATATGTCACC
CCAATTTGTGGCAAACACCATTTCAGTGTGACCTCTATATTAGCGTGGCAGACACCAATTTCGCTAGTTGAAGTTTACGTCAACGTAGCAATTGTCCAGC
ATTTCGCCTGACAGTCTCCAATTGTCATTGCCGTTGCCATGGGCGTCGCCAGGAAGCTTCGCGTGCTGTGCATGCACGGATACCGCACCAATGCTAAGAT
CATCGAGGACCAGACGCGTGGATTACGCAAGGCGTTGGCGCCACACGCCGAGTTTATCTTCCTGAACGGCCCCATCGAGGCCCGCGGACCGTCAGACGAT
GTGATTGAGAAGCTGTACGCCGAGCACAAGCCCTTCTACGAGTGGGGGAGCTTCATAGAGCGTGAGAGACCGCACCGCCTCGACCCGGAGTCCCAGGAGA
TCGAATATCTGGACGGTGGCTGGTACCACGACTACGTGGACTGGGACAACACAGTCAAGTACATGGACGAGCAGCTCCCGAAGCTCGGACCCATCGACGC
CGTTGTGGGATTCTCCCAGGGCGCGCAGACAATGACGGCGATTACGATGTGGTACCTACATCACCACAACAAACGCTGGTGGAATTGCTGTGTGAGTGTC
TGCGGTCCACGCGTGCGTGGGGCGGCACTACGACCTCTGTTCGAGAATCCCGATGGAACGAAGAAGCTAGTGCCGATGCCGTCGATCCACATCGTTGGGA
AGACGGACAAATGGCGCAGTGGCTGCTACGAGATGATCGACATGTACGAGGACCACCCCAAGGGGACAGCGCGCGACAAATACGTATTTGAGCACGACAC
GGGACACCGTTTCCCGACTGGAGAACGGCACGAACAGCTTTACGACGAAGTGGCGCAGATCATTCGCTCGCACTGCGAGTCCCAGGCTGTGAACAAACGG
ATCGCGTGAGGTACCGTAGAGTCAAATAAAGTAAACATGACAGTGTTTTCCTGCTCAACCGCGAGGCACATCACCACACCTTGAAGAAGGCGTTCACTTC
ACGCTAAACGCAAGGAGTCTCCTCAGTGCCGACAAAGTGACATTGCTACTGTATGAGTCATACTATGACGGTCATAACGAAGAAGCTTCGCGTCCTGTGT
CTTCACGGGTATCGCACCAACGTGAAGGTGATGCAAGACCAAACGCGAGACCTGCATCGCGTCATGGCCCCTTACGCGGACTTTGTGTTCGTTACGGCTC
CGTTTGAAGCTCGCGGGTCTTCTGACGAGGTGATCGAGCGGCTTTACAGCGACCACGGCCCGTTCTACGAGTGGGGCCACATTACAAAGATTCCTCGCCA
GCAGGACAGCAGTGACAACGGGTGGTATCACCAGTACGTTGGGTTCGACCGGGTCGTGAAACACATCGACAAACAAGTACAAAATCAAGGGCCGTTCGAC
GCCGCTATCGGTTTTTCACATGGACAAATGCTCACGGCTTTGACGATGTGGTATTTGCACCAGCGCAATGAACGATACTGCTGCCTCATTTGCTCAGGAA
CCCGCGTGCGAGACGTTGGTTTGCGTCCGCTATTCGAGCACTCGGACGGCTCGCAGAAGCCTGTGCCGATCCCTTCTATCCACCTCATTGGCAAGAAGGA
TCAGTTCTACAACACTTGCTGTGAGCATGCAAAACTGTACGCTG