Description :
From Genome Similarity Track
Location :
Scaffold_36:507624- 512365
Transcript NameFunction/comments
Phyin_T30-4PITG_14632Putative uncharacterized protein

Sequence
4741 bases(100 bases per row)
CGTTGCAGTTGAAGCGGCTAGTGGTCCCGCACGCTAGTGTGGACCACACCGGACGCAGAAACAAACTCGACTCATATTTTTTGCACTTTCACACCAGCGG
GAATGGCGAATGCGGACGACTTGATGATCGGAACCTTGACCCGATCAGACCGCTCGGCCCGATTTGCATTTAGGCCGAGGCACGCCACCACCGCCGCGGT
GTCCGCAGACTACGCGTCGGCGGTCCAGGCCTCAGGTGATCCGAACAGTACATGTACATGCGGTGCTCTTAGTCCATGAGTCTTAGAGCACTGCTCTATC
GGAAAGTCTATCCGCAGCTCGTCCGTGACTGCGCGGCGTGACTCAGCGTGGCAGCTGCCGCGTCATGGGGCACTCGTGATAAAGACGCGCGATTGGGACA
GAGCCGGCGGCTCTGTCCAGGTCGAAGTGGTCCCTCCACTGTCGTCGACCTTGCCATGCATTGCCGTCGGCTCGGCAATTTGCCGAGCCGAACATGTCGA
GTGCGGCCTTGCCGGCGGAAGCGCGCGCGAACGTGCGTCGAGCAGGGCCCGTTTACTCTTCAACCGCGGCCTGATATTCCAACTCAGGGCGGCGGCATCG
TTACGCTTGCCCCCAGGGTCCGTGGCCGTTGCAGAGTAGGCTGTGAAGAGCTCGGTGGGGAGCTCGGATGACCCGATACGACTCGTATCATGCGAGCACT
ACAGCTTCCTTTGACTTGGTGTCATAGCGCCCATTGCCAAGATCGCTGAACCCACGCCCGTTTTGGCAATCGCACGCCAGGCACAACTCGGCGCCAGATC
GCGGCAGACGAGCACAGCGCTCTGATTGACAACGTCCCACGGGACAAGGCAATCGATGGCAATGGCCAACTTGTCTCGAATTAATAAAGCCGCCCCACCG
CACACGTTGTAGTGCATGGATAGAGCCTTGAACCTTGCGAGGAGCAGCCGCAACGAACTCTCACTGCAGTGAGGAGTCTGCTGGCGTGGGCAACCGCTCG
AAGCATAGTAAAATAGTGGCGGCTCCAAGCAGCCAAGCACGCAAAGGCCGGAATAAGGCAGAGAGTCGAGTGCAGTTGACGACGAGATCGAACAAGAGGG
CTTCTTGTTTCATTTCGCCTGGACACCACCACGGGCAGTGCCATCAAACAAGCGTGATACCGGCTGGCGTTTCTAGCGGAAAAGTGCCCCTTTTTTTCGA
GCCTACCATGACATTTCGCTTTTGCGCGGCTGCAAGAATTCACCCCAGCAGACTGCTGAGCAGTAGCGTTACCAGCAGCAAGCTCTGCAGCGTGGCAGCC
GCGCGGGTGACTATAGGTGCCCGCTACTCACCGCGGCGCCTTGGTCACCTCGTACAGGCACTTTGGCACCATGGCGCAATGGCAAAAATATTGGCCGGAT
ATTGCCGGCCGCCACAGTCTTCTGTAAAACAAAGTGTTCTCTTTGAATCAGAGGCTTTAGCGGGCCGACAGGTTTTGACTTGAGATGAGTATGCTTCGCG
CTCCACCAATTGGCGTGCCTGCCCATCTTTCTTGTTGTGATATTTGCCAAGTGCCGATTTTGCCCGACGCATCCGAATTTGGAAGGGAACAAATTGGAGT
GGCACACTCCACGACACCCGCAAGCCTCGCACCCAGCCCAGCGCCGGGCCAGTACCATTCGCCATCTTGCTGGCCACGACACACACAGACAAAAGAGCCC
TCCGGTCGCACGTGTCCGTTCCGCTCGGGCCCGCCGCTGCTAGTCCAAACAGAGAAGCAATCCATCGCAGACCCCGCGTGGCCGTGCAGTCAGAGCACAG
GGAGTGTGACAGGGAGAAAGAGAGAGCTAGGAGCAAAGCGATCAGAGCAGGGATGGAGATCGCCAAGAACGTTCGCGACTTCCTCGTCGGCATGAAGGAG
ACGCTGTCCCCCGAGGAAGACCAGTTGCTCTCAAGCCTGCAGACGCTGCACGAGCAGTACCTGAATATCATGGATGACTTCTCGCTGCAGGTTTCGGAAA
AGGCTCTGAGCATGAGCCCCGAGGCGCGGCAGAAGGCACACCAGCTGCGTCTCAAGATCTACCAGGACTGGCGCGCCAAGCTGATGGAGCGCGTGTTCGA
CAACTCGAAGGATATCGCGTCGGCCGAAGACGCGGAGATGCACGCGCCTGGGTGTGACTGCTGCTTCTGCGAGCTCACGCGGTGGTTGAGTAGCTACGAG
GCCGTGACGACCGAGTACATCCAAGTGAGCACCCGGGCTAAGAATCCGGAGAACGACGGTGGCGAGGACATCGTTTTCGAGATGCCGGACTTCCTGACCA
CTTAGGTGGTGCGTAGTCGGGCACGCCAAGCTAGTTAGGGATTTCTCGGCAGCGAGTGCGCCGGGAACGCCCGCGGATCTCGTGTGGAACGAAGAGAAGG
ACTGCATCGCGAGATGGGGACCGACCCAGCGCCTCGGGGAGGCTGCGGAGCAGTACAATACATGGAACTACTACAACAAGAAGAGGCGCTTGCGCGGCGC
CGCGATCGTGGAAGTCGCGGCGGCCCCGGCGCGAGCGAGAGGGTGTGTGTGTGGAACAATAGAAGTGCTCCGACTGCGTCTTCGCCGTCACCGGAAGCGC
GTGCATTACAGTCGGTAGTGGTATTATGATCCCCCCGCCTCGGTGCGCAGGTTTATAAGCAAGATTATAAGTACAAAGGGCTCATTTGAATTGTTCTCTA
GTAGCTAGCGCGTCGTGGTGCAGGCAGGCAGGGGGCAGAAAGGATCGATAGCAACAGCTTCGCGTCGCCACCCTCGCCCCCGCTCTGGCCGCTGCGCACG
CGCCAGCACAGGAGGAAACGAGCCGAGTAGAAGAGTACGCGCGCGTGCAAATAACCTGCCGAGAATGCAGAGAGCTTCAAACAATTATTATGTGCCGTCA
TTACTTTTGCCTAATGGTTCGGGGCCAAAAAGTATCCTTTCTGCGGTGCCGACCGCCCTGCGCACGTGCGTGGCCGGCAGTGAGGCCAGCGGTGAAGTCG
GACATGCTTGCCACATGGCACTCGCACTTCCACGTTGCTCAGCAGCGTTGAAACCGCGGAGAGCTTATGCTGGCCATTTCGGCGTGCTGGACAGGAGCGG
TTGGCGGTGCGAGGAAGCAGCATCGGCGTCGGCGTCGGCTCCAGGATATCTTCGCCGCCAGCGCGTTGCACGCGGCCGCGCGGGCGGGAGCCGCGCTCAG
GCTAAGGAGCGACCAGTCTATAGCCTTGAACAGGCTGGCGTTGCACATACGCCATTAGAGCCTGTATCCTCAATTTGCGCAAAGAAGTTGCGAGAATGTG
TTTCGAAATTGCACATAAGTGTGCAAACCAAATCCTCTGAAATATAGTACTTTTGTATGCGCTATAGCAATGAAATCAGAGTTAGCAGCCATAAAAGAGG
GAACGATACTCAGGCACAGAAACTAATCAAGCACCAAAATATCAGGTTTCACGCACATCAAGTCTGGCAGTACGGGCCCCGCAAAAATCTTATTTTTCCA
AGTGAGAAAATGATGCGAAAAGTCTGGTTTTGACTTGATCTTCGGCCGAAAACGACCACCTGAAATTCAGGTGTGTCTGCAGTGTACATGTACCGTGGCA
AGTACTTGTTGCGTCCCGAACCGGTACTAACAGAAGCTGCCTTTTCAGCGAGTCACCAAGATTCTCGTTCACCAAGAATCTTGGTTAACGAATTGGTGCG
CGACTTCCTCCAGTTGCACCCCTTCTCTGCTTCGCCGTTGGGCCGTGGCCAGTGCCGGAAGCAGTCGGCAAAACCCTTGCCAAAGGTGCCGCAAAGGCTC
GGCCCCGGAGTCCGGGGCCTGCCGCTGCACTTTGTCCGGGCCGGACTGCCCGTCCCCCATTTTGCCAATTCCACTCTGCAAGTGACTCTTTCCTTCTAGC
ATTGCTTGCTGTCCAACTGTCAGTGACTCACTGAGTCAGAGCCAGAGTAGCGATCTCGCGCTGAAGAAGACGGAGGCGGTGGCCGTCTGGGCGGGTCTGA
GTGCAAAGCGAAGCAAGTTGCACGATCCTCCGAATCGTTATCATCGAGCTCGGAAACTGCAGTGCTCAAGGATGAAAAGCCGGAGGGGGGCCTTGATATC
GCACTGCGAATCCAGGCGACTTTCGAGAGAGACCAGCGCTTCGGTAGACGCCACATGACTGCCATACAGCAGGGAGCGCCACCGATTCTTGAAGGCGAGC
TTGCGTAGACCATGCATGCACCGATAAGCCGGCGCATTGCGGAGACACCGCAAGAGGCTTTATGCATTTGTAGATTAAGTGAAGTTCTTTTTTTAAAATA
TCCTCTGAAGAAGTAATAAGATCTTGAAGCACATCTTGCAATCTGCATATGGTGCTCCATTTATGTTTGGGCGCTCCTTATTTAGTTGGGCGCTCCTTAG
TTGGGCGCTCCTTAGTTTTTCTCGGGCAGATAAAGGACAACAGCTGCAGGTCGTTTTCGTAGTCGCGACTTTTCAAGGTAAAATTCTGATTAGCATGGCG
GTGAAATGTGACGACAATCTCTGACGGGACTTTCTGTTGCGGCGAGAAAGCGTTGGCATGCGCATGAAGCAAGCCTCGTTTGCATCGCGGCGCCGTCACG
ACAGACGCTGCGTCTAAGACGCAAAAGCGCGCGAAGAGAGCTGACTCACAATCAACAGCGACGCATGCGAGCCAGCCAAGCCCTGAGAAAGTCTCAGCGT
CACGCACCGCCGCTTCTGTTCAAGATGCGATGGCTTCACCC