Description :
From Genome Similarity Track
Location :
contig_39:507580- 510578
Transcript NameFunction/comments
g7011.t1hypothetical protein
g7012.t1hypothetical protein
g7013.t1hypothetical protein

Sequence
2998 bases(100 bases per row)
GCTCACCTTCATCCGGTACCTGTCAAGCTGTCGGTCCAAGCTCTCTCCGACGGAGGAAAATGGGAAGTGTCCTCTGCAATAGGCAACCCCGATGGCAGAC
GCCGTGCAGCACTGCACTGCGTTGCCGCGCCCCAAGCACGCTCCATGGCGGATACAGCGGATCCATGCTGGTCCAGGTGAAGTTCGCCTGAATTGGTCGA
TCTCTTCAACAGAGACCAGGCGGGCCGGCTTCAGGGGTGCAGAGGCGCTGCGAGCGCCGAAGCAGACGCGGACGGCGGCGCTGCTCAGCGCGGCGAGATC
AGGTTGAGACAGGTGTGAGTGACGGCTTCACGGGCAACTCTCCTGACAGGCCTGCATTGCTGCGATCGCTCGGAATCTCTCGCAATGCAATGGCGGCGCT
GTCGTAGCGAGCGAAATGCATGAGACGACGGGTAATACACCGCAACTCGCTCGCTCTCGTTAACTATCTCTCTCAACTGTACACAGCATTCCTCGTGGCA
TCAGTGCTCCCTATGGCATCCCCTGCATCGATGAGCTTGTCGCCGCTGTCGGGTGCGCTTCGAACAGAAAGAAGCGGGCGGCGGCATTGCAATTGTGCCG
GAAATGGCGCCTGCGATTGTCTGCTACACCGGCAATCTCCGCATGTCACTCACAGTGGATCAACGCGAGGATACCGAGTGGGACTTTGCTCAGTCAGCGA
TGAGTCATGCGGCAAGACAAAACAAACAAGTAATCCCCGCCCCCACCACCATGAGTGTAAGTCGAGAATGGAAAACTGCACGGATTCAATTTCCGGAGTT
ACTAAATGAAAGTCCAACAATCATAGCTCCCAAGCCAGCGCTCCGGCCCGAGCGCTAGCCAATGCTATGGATACATGTACCTCACTGGGACTGCTGCTGA
TCCTGGTCAGGCAGCGACGTCACGGGGCACGGAGTGGTGGTGGCGGGGGTCGTCGTTGTGTCAGGCAGCGAGGTCACAGGGCAAGGCGTAGTGGCTGCCG
GGGTACTCGTCGGGGCATCCGTGCTGTCCGGAAGAGAGGTCACCGGGCATGGCGTCGTCACAGCAGGCGTCGAAGTAGGCGCGTCGGTCGTGTCGGGAAG
CGAAGTCACCGGGCATGGCGTCGTAGACGAAGGCGTCGAGGTAGGCGCGTCGGTCGTGTCGGGAAGCGAAGTCACCGGGCATGGCGTCGTAGACGAAGGC
GTCGAGGTAGGCGCGTCGGTCGTGTCGGGAAGCGAAGTCACCGGGATGCGTCGTAGACGAAGGCGTCGAGGTAGGTGCGTCGGTCGTGTCGGGAAGCGAA
GTCACCGGGCATGGCGTCGTAGACGAAGGCGTCGAGGTAGGTGCGTCGGTCGTGTCGGGAAGCGAAGTCACCGGCAAGGAGTCGTCGCTGACCTCTCCGA
AGCGCCTGTATCCGGCAACGACGTCACCGGGCATGGCGTCGTCACAGCAGGTGTCGAGGTAGGCGCGTCGGTCGTGTCGGGAAGCGAAGTCACCGGGCAT
GGCGTCGTCGCAACTGGCGTCGATGTCGTGGGAGCGTCCGTACTGTCAGGGAGCGAAGTGACTGGGCACGGTGTGGCAGCCGTAGTCGACGTAGGGGCGT
CAGTGGTGTCCGGCAAAGAAGTCACAGGGCACGGGGTCGTTGACGTGGTTGAAGCAGGAGCATCGGTCGTTTCCGGGAGTGAGGTAACAGGGCACGGCGT
CGTGGTCGCAGTGTCCGGTAACGAGGTCACCGGGCATGGCGTAGCCGTCGATTCCGTTGATCCGGCCGTAGATGCCACCGTGTCGGGGAGCGAAGTTACC
GGGCAAGGAGTCGTCGCTGACCTCTCCGAAGCACCTGTATCCGGCAACGACGTCACTGGGCATGGCGTCGTGGTTTCCGTGTCTGGAAGCGACGTGACCG
GGCAAGGCGTTGTCGTCTCGGTGTCCGGCAGGGATGTCACTGGACACGGAGTCGTCGTCTCGGTGTCCGGGAGCGACGTAACAGGGCACGGCGTCGTGGC
TTCAGCGTCAGGGAGTGAGGTGACCGGGCAAGGAGTACTGGTCTCTGTGTCCGGAAGAGAAGTCACTGGGCAAGGAGTACTGGTCTCTGTGTCCGGGAGC
GACGTAACAGGGCATGGAGTCGTCGTCTCGGTGTCCGGCAGGGAAGTCACCGGACACGGAGTCGTCGTCTCCGTGTCAGGGAGCGACGTAACAGGACACG
GGGTCGTCGTCTCGTTCGTGTCGGGCAGGCTGGTGACCGGGCATGGGGTGGTCGCGTTGGTGTCCGGCAGACTCGTCACGGGACACGGTGTCGAAGAGCT
ACCGGTGCAGCCCACGGACGGGAACACGCAGCCCACGTGTCGCCGTTCACGATGGTGCACTCGGCGTCCTCTTGCGCTGTGCACTGCGATCCGTCATACG
ACGGCAGGTATGAGTGGCAGTCGGCCGTGGCCGCGTCGCCCTTGAGCGGGCAGGAGGTGCCGGCAGGGGCGCTGCCTGCTCCTGAGCAAATGGCGCCGCG
CGAGTCCGCGATCGTGTAGGTAGCGTCTCTGCAGACGGAGACGTCCGTGTCGGCCGAGGCCGCCACGACGGCCAGCGCTGCGGCCAGGAGCGTCCTGGTG
GTGGCAACGACCTTCATGGGGTGTAGAAGCTGTGGGTTTGGTACAGGAGTCTGCGATTTCCTGTGAGCGCAACGCCGGAGAATTGGGAAGTGCCCTGCAG
GATAGAGGCAAAGGCAGGCGATGGTCAAAGCACGGGATTCACTCACACAGTTGCAGTTGCTACGAAAAGGACATGTGGCAGGATGACTCGCTCTCAGTAT
GGGAAGTGCGTGCGGAGACCGTCTTTATCGTCCGCTTGGGCAGATTCCTGTGACAAAAGGCGAGTGAATCCGTGCGTAACTCGAGCGCTCAGCAGTTTCT
GCGCGGCGCTGATCACCTCGGAGGTGACCTCGGCCGGATGAACGCGTCGGTCACTTCGCTCGGCCGTGCCCCAGCACTCGGCCATGCGATCGGTCGGG