Description :
From Genome Similarity Track
Location :
Scaffold_222:50751- 52042
Transcript NameFunction/comments
Aphin_H310_13533Nol9 protein

Sequence
1291 bases(100 bases per row)
TTTCGTTTGAGGTTGTTGCGGCTCTCCATCAAGGATGCGCCTGTTCCTTCCGCGGCCAACACGTCGACGACGACGTACGGCGCGCATCCGTACACGGCGC
TTTGGTCAAGCAGCTGGAACGCGAGGGAAATATGTCCACGCACGAGCAAGTTGACATGCTGTAGAATCTCAATGGGTACGGGTGTCAAAATGTGAAACTC
ATGGCGGTCCACATCGATGCTCCGAACAATGCCTAATCATAACATGCGTTCATACCAAATGAATAAAGGACGACAATGGCATGTACCGTGACCGACACAA
GGAACTATGGGATTGTCCACGACGGCTCTGGGGCCATTGTGTTCCGTGGCATCCGACGCCATCTCGAATGGATGAATGCACAGACCCACAACACTTGCAT
TCAGGACGTGAAGGATCTGACTCGGAGGCACGGACCCCCCCGACACACGCAAGTTGACCTTAGAAAAAGGAACGCGGTATGGAATTTGTTGTGGGTATAT
CGTTGAGAGTAGACGGGTATACCTACGACAAAGTGCCAAAGTCGCACGCAAAGTCGATGAAAACGAGAAAAGCTACCGCGTCTGCTCGGATGTACAATGA
ATGCTTTGTAGAGGCACATGTGATGGCACTGGAATCCGACCCAGAAAATACGCGTGTAGTCGGAACTGCCGCAGTTCTTTCCCACTTCGTGCAGGCTGAG
GCGGCTCGACATCCCACATTTCAATCGGATGCAACGTCCACTACACTTAAGGGCATGAAAAGGGTAAGGCAACGAGAGTTCATCAGTACCTGAGGCGACG
CGGGAACTTCGAAACTTTTCGCCTTGGACAAAGCCACGACTTGGACTACGTGCTTCGGGGAGGCGGCTGTCAGAGTCGCTTGTAGGAGGTCATAGCCCAT
GCTCTTGATCCAACCATCCGTGTTGATAACCAGCGGAATCGCAAGGTCTTTTGCCGAGTAGTCGTTCAGCAGCGCCGAGATCGCGTCCATGTACACGGTC
GGATCGGCTTTTGGGCTGCTAAAGCCAAAAAAATACGACCTGCACCCAAACATGAACAACCGTAGTTTGACGGGACGATGAAAACTCACCGATACGCAGG
TTGGAGATGAGTGTATCCAGGTCCCAGCAACGGCGTCGTGATGTAATGCAGGGAGAGCACACCAGGTGCGGCAAGTTCCGGCTGCCCAACGTCTGTATCC
AGATAGGCCACAATGGAATAGACATTGAGCAATTGGTTCACCAAATACCGGCTGAAGGTGGACTTGCCCACACCCTTCGCCCCGCAAACGA