Description :
From Genome Similarity Track
Location :
Scaffold_2041:5071- 6249
Sequence
1178 bases(100 bases per row)
AAAGTAAATTTCGCTAAAGACCGTGAAAAAAGAATTTTCCAGCTAAGCAACCTCCACGGTACACGTAAAATACGGAAAGCATATAAATTACATACAAGGT
GTTTACGGTATCGACGCTTTATTTACGAGAGATGGATAGGTTGACATGCGCGATATATGTGCTGCTGTAAGCAGATGCTATGTCGCTGCTGACACTACAG
TCGCTACTCAACCAACCAGCCACATAGTTAGCTATGGCGCGCTCCACTACTCGGATACCTGCCAGCATTCCTCGTGCGAATAGGACACCTGCTTCGTTTC
TTTTCTCAGCGGTTCATGCACGATTGACCTTGGAAGGACCGGAACAGCAAATCATGCATGTACCGTGCAGCTCCTGTGTTAAGTTGGCTGGATGTTCCGG
TCCTTTCGCGACCGTGAGTGTAGGTTTTTCCCTGTGACGTTTTCCCCCCATCTCGCTGTGGCTATCTCGCCAGTTGATTCATTTGCGGTACTTGCGACTG
GCTCGTGGCGTATTTATTCAGACGATACGATCGCAAATCATTACCCTTGGCACCACCTCTCTCTCTTTCTGAATCAAGGCGATCTAAGTCGCCAAGTCAC
GTCCCGCCGTACGCATACAGGATACGGCTTGATTGACATCTTGACCGAGGCATCTTATGTCGGGTTTGTAGCCACCTAGGTCGATTGTAATTCTTGGAAG
ACCAGTCCAATTTGTCGACGCTATGGGGATCAAGACAAGCTGTCCACCGAGCGGGTAGTGAAGACGACACGCCTGAAATTCGTTCGACACGGCTACCATG
TTTGATGGAACCACCTTACGTATCCGATGGAGTAGGTGAAATTATTAACGCGCGTGAGGCTTCGGCTGAAGTTCACACACATGGAGGAGCGACGGGGTGG
GAGCTGCCACTACATAGCAGGAAACGCAGTTGCAACGAATATCACTCGAACAAGTAGAGGATGACACTCGAGTACATTTGCATTGTATGTCGACAGACCT
CTGGCCAGTGACTTTCGCTAGTACCATGCGAATCGGAACTCTTCGTGCGTGTGAGATTGCTTTTGAAACTGAAGATAGGGTTGTCCGAGACACCCCACGA
GGACAGACCTCTACTTCTACGGATGAAGCTGGATCCAAATCGAGAAGGTAGGTTGACATCCAATAGAAATCGTTGTTG