Description :
From Genome Similarity Track
Location :
contig_86:50703- 57425
Transcript NameFunction/comments
g10462.t1hypothetical protein
g10463.t1conserved hypothetical protein

Sequence
6722 bases(100 bases per row)
TGGATTGTCGTGCTCTTTTTTCATGTTTTCAATACGGGTTACTCGGTATCTCTCGCCTACGTTTATCACTACATGTCTTCCCCCGCAATGGACTACTACG
TCCAGCTGTTGCGAATGATGCCACAAGAAAACTATAATGGAATTATCGCTCTCTATGCCTGCATTGGGGCCGTGAACTTTTACAGTGCGCTGAAGATGTC
TCTCTACTCGCTGTACTATCGACGACTGGTCTTTCGTAAGATGGCGGATACGAATATCGACACAGAAGACGGCAAGAGAATGAGGAAAAAGAAGAAAATG
TAGGTGTTTCAACGAGATTCCGAGCATTAACACGTTTCGCGTCTGGATTTGCACGAGCCACCAGCGCTCGCGGCGAGTGGTTCGATACAGTTCTGCTCAT
GCGAGAGGTAGCCGAAATTTCATCTCAGACTGTGCAGGCTTACTCATCGAGCTATCTCATCAGCAGTGTCTGGATGAACCAGGTATTTGCAGGGTTGATC
TTCTTGAACGCAATTGCTAACACGCTCGTGCACTACAACCTGGAGGGAAAAGTTGGTCTGAGGCGGTTGTACAGCACTGCGATTGATCTGTCACTAGACT
TCGCGTGGGGTTTTATAATTCCAGGGAAGATCATATTCGTCTACATCTCGATGTTCATGGCAAACAACGGTTCGTTTCCAAACGAGTTCAATTACTCCGA
CACGCTCCAAATCAAAGCAATCTTGGAATGCAACCAGTTCTTCATGGTTACGTGGTTGGATGCGGTGACCACGACGTTGCCATACCTGAACATGCTTTCG
GGTCTGCGAAGCGTAAAATTCTTAATCAGCACGACATGGAGGTGGTTCGTTTTATTTCATCAACGAAAGTCCAGCCTATAGGGCCGACGGCACAACTTGC
AAAGCTGCAAGGGGCTGTCGTCGCCCCAGATCCAGCGCAAAAGGCTCCAGGATTGGCAAAAGTCGCGGACTCCGAAGAACACCAGGTCGAAATAAAGCGC
AGCGTCTGTGGAAGGCTAACAACAGGCGTCGTAGCACTAATGCCTCTCTGTGGACTGTTTGTCCTGCTCACATCTATCACTTCATCGGGGGTATTTTTAG
CGGCGAACGCACATGTGCCGTGGGTTGCAAATTGCACATGCACCCGTGGTTCTCTACGAAGTGTTCATGTTCAGTCATGGAGATGAACTGCTTCGAGCGG
GGTATCACTGGTCGCGAAGCCGAAACTCGTAACATTCTGCAGTCGCTCGACCCCAAAGTGTTGAACTCTCATCATCTCGCACTGCCCTGAGCTTGTTATC
ACCGAGGACATTCGCCGGTTCAGCAATCTCATGGCTCTCGAGCTGTACAACTCGACGGTTGTAGAGTGGTTGAGTGCCGCGTCCTTGTCACTTCCCTACA
TTCCGTCCCTCACGACAATATTTGTCGTGCGATCTCGATTCCTAGGACGGCCTCCCAGAGGGTTTAACGACCGATTTGTCGCCGAGTGTCGTGGACGTCG
AGTTCGTAGCGTCGGATCTCGGTGGGCCATTACCAGACGACCTCGACGAGAAGTGGACGTCCGTTATAATGCTGTACTTGGAGCACTGTGGACTGCAGGA
GTTCCCACCTGCCATCACCAGGATGAAGCTGACGGATCTGTCCCTGGTGGACAACAACATCTCGGTAGTCCCGGACAGGATAAGCGAGAGAGCCATGTAC
GTTATGCTGGACCGCAACCCACTAAGTCACATCCCCGACAGCTACGCGTCTCTGCGAGAGCTCTTCTACTTGTCGTTCCAGTACACCAACATCGCGTCAC
TTCCGCAATGGCTGCAAGATCTGCGAGCGGAAGGCGCCGGCATCAACTTCCGAGCGCTAGGCACGCCCTACTGTCACGACCTTCCACTCAACAGCTCCGA
GGCAGTCTTCGCCGCCTGCAACTGGGACGACTACAGCCACGGCATATTCCCGTTACCCACGAGGGACCAAGCGCGTGCCATCCGCGACTAACGTTCATTG
AAAAACGAATCATTGACGCAATCGACCATCATTCTCCCTAAAGTCAAGAAAATCTTCCCTGAAGTCAAAAGTCCGCCGTCGGCTCAGTCACCTCCACTTT
GTATTGCCAATGTCGCTGCTCCACGGCCGCAGCATCTTCCTGCGCGGCGTGCGGGCCTCGAGGCGGTGCAGCGTGCGCGTATCTCGCCTATCGCGTCCTC
GCTGCGGCTGAGTCGCCGTCCGTTTGTGCTGCCTGCGCTGGGCAGCGGCGTGTTGAGCTTCTCGACGTCGGCGCTGGACGAGCATGAGAAGACTAAGAAG
GAGAAGAAGCAGCTGAACGCGCTGAGCGGCATGGGGCTGGACCGCCCGCCTGACTGGCAAGGAGATCCTCAGCTTCTTGATGGGCCATTTATGGCCTAAC
GAGGACACCAAAGAGGCCAAGGAGATAAAGCAGAAGGTGCTTATCTCGGCGGGTCTCGTGTGGCTTCCAAGGCGCTGACGATCCAAGTGCCGTTCATCTT
CAAGGATCTGGTGAACAGTATGGGAGAGGCCTCCAGCGTAATGGCAGGATCGCCTGAGATCGCGGTGCCCCTGGCCATGGTGCTCGGATACGGCCTCGCT
CGCTTCAGTGCCAGTGCGTCCTCGGAGCTGGCCAATGGCGTGTTCGCTACCGTGGCGCAGAAGACCATCCGCAAGGTTGCAGTACGCGTGTTCAAGCACT
TGCATGCGATGGACCTCAAGTTCCACTTGGACCGACAGACGGGAGCGCTGTCGCGCATCATTGACCGCGGCTCGCGATCCATTGATTTTGTGCTGCGTGC
GATGGCGTTCCGGGTGGTGCCGACGGTGCTGGAGATTGGACTGGTGAGCACCATCATGGCAACGAGTTTTGGGCTGCCGTATGCGGGTGTCACGCTTGGT
ACTCTCGCTGCGTACACGACGTTCACGGTACTGGTCACGCAGTGGCGTGACGAAATTCGCCGTGAGATGAACCGACTTGAAAATGAGGCTGGCGCGAAGG
TGATCGACTCACTGATGAATTACGAGACTGTCAAGTATTTCAACAACGAAGATCACGAGACTGCGCGGTACGATGAGTCGCTGAAGGGATACCAGAATGC
GGCACTCAAGACGCAGACGTCTCTCGCAATGCTGAACGCCGGACAGAATGGTATCTTTAGTGTTGGACTCATTGCTATCATGTACATGGCGTGCGAAGGC
ATCGCTGCCGGCACGCTCACCGTTGGCGACCTGGTGCTTGTGAATGGTTTGCTGTTCCAACTGTCCATCCCGCTCAACTTCATTGGTAGCATCTACCGTG
AAGTGCGCCAGTCGGTGACTGACATGGAGTCGATGTTCAAGCTTGGTGCTGTTTCGCCCGTTATCACGAACCCGGACGAAAATCTGAGCCTACAGGGCAA
GGGGCCCAAGTCGATTGAGTTCCGTGACGTGGACTTTGGATACCGCCCCGAACTTCCGATCCTGCGCAAGACGTCCTTCAAGGTAGACGCTGGCAAGCGT
GTTGCTATTGTCGGCACGAGTGGCTCTGGTAAGTCCACAGTGCTTCGGTTACTCTACCGCTTCTACGACCCACAGAACGGTACCATTCTTATCGATGGCA
AGGACATTCGCCAGCTGAGCCTGGATGAGCTGCGCCAGGCCATCGCTATTGTCCCTCAGGACACTGTGCTGTTCAACGACACGATCTTCTACAACATCAA
CTACGGTCGTCTGGACGCCACGCCTGAGGAAGTGATGAACGCTGCCCGCGTTTCACAGATCCACCGCTCGATCGAGACGTTCTCGGACGGATACAACACT
CGCGTGGGTGAGCGCGGACTGAAGTTATCTGGCGGTGAGAAGCAGCGTGTGTCAATCGCGCGCGCGATGCTGAAGGACTCGCCGATCCTGCTGTTTGACG
AGGCTACCAGTGCCCTTGACTCGGAGACCGAGTCGGAGATCGTGCGTGAGTTCGCTTCCATCGGTGCGAACCGCACGTCGCTGATCATTGCTCACCGTCT
GTCGACCATCCAAGACGCGGACGAGATCATCGTGTTCAACAAGGGCCACGTGATCCAGCAGGGCTCGCATGAGGAGTTGCTGCGCGACGTGGAGGGCAAG
TACGCCGAGATGTGGGGTCGCCAGAACAACCACGTGCTGGTCTGCTTGGCGCCGGCGACGACGACGACGACGACGAGGCCAATACCCTGTAAATTGAACT
CGACCACTTCAACTACAACGTTTTCTGTGGTTCACACAACTATGTCATTCTTCTATTTAGTGACAGTCTAGAGCCAAAATAGAATCGCAGCATCGCACAC
ACCAGCTCCCTCCGCGATGGACGCGCTGCTCGTGGGCGAGGGCCGCCTGAGCAGCAGCTCCAGTTCCTACAGTTCCAGCGACGACGAGCCCTTGAGTCTC
AGCCTCAAGCGCCACGGCGTGATGGCGCCCCCTCCTCCGCCGGACTCGCCGCCGCCAGACATGATGCCGCCGCCGCCTCCGCCTGGACCGCCTCCTCCCG
TCGACACGAAGCGCAAGCCGTCGAGACCGCGGCGATCAAAGACCAACACTCCGACAGTCGAGAAACGGGCACGGAAGGTGACGCCCAAAACGTTGGCGAG
GAAGCCGAGAGTGCGACGTCAGGCGTCTCCCACGAAGCAGCAACAGGTTGAGACGCCCGTCGAGAGTGTGGAGGAGGAAGAGGAGGAGGAGATGGACGAG
GAAGACTTGGACGCGTACTCGGACCAGTCTGACGTGTTCGAAGACGACGTCGAGGCCATTTTGTTCGCGGAAGAGGAGGAGGATCGTAGCAAAGGCTACA
CGGACTGTCTGACAGAGACCCACTTGGACAGCGCAGAGTACCCGTACCCGGCGTACCTGGCCAAGCTGTCAGCACTGTTTACGGAGCAAAGCGCTTTCGG
GAAGAACCCCGAGGACTTTATTTATTGCAACAACCTGCTGGTGCGTTCCCGTGGATTGTAGTGATGGATCTGTATCGTAGTGACTGATGAGGGCGTTTCG
TGTTTGCAGGTTAGTCCGAGTCAACTCAAACTTATGGATGAACGGACCGCTGCACTAGAACGTGGGAAACTGGAACAAGTGCGAACAGCAACAGCGTTGA
AGGCGAAGGAAGATGAAAAGAGGAGAAAGCAGGAGAGGTGAGAAGAGTGTGATTAAGCATGCGCAGAGAGTTTAACCGTGTTGAAAGTAACACTGACATT
TTTTGTGCTATTACAGACTGGTCGAAGCGCTGGAACCGCCTGCAAAGAAAATTAAAATATCAGAAGCCACGCTGAAGGCATTGGAGTCCAAACAATTAGT
ATCTGGGAGCACGTCCAGACCGACGAGAAATCCAAGTCGAAAGAGGAGTCGAAAGAAACCTGCTGCACCAGCTGCAGCACTTCCTGCAGTCGCGACAGGT
CCGTTAAATCCTCCTAGTGACGCCTCAGCGGGTAATAGGCAGCAGGTGAAGTCACGGTCGAAGCCGGCAAAGGCTGGCAAGGCGAATGGGAAGGCGAGTG
ATAAACCCGTGACTACCTCAGCTGCTAAAAAGAAGACGGCGACTGCCAGTAACCGGACGAAGAAAGCGACAGCCACAACTACCAAGGCAGCAACCAAGGT
TGTGGCCAATGGCACGTCGAAAGCGATCATTTCAAAAACAACCAAGAGTGCCCAAGCTAGCCAAAAGCCAGTGGTGCCTGCTAGTAGCGCAAAGGCAACG
AAAGTTGAAGTGGGAATCGAGAAGAACCGAGCTGGGGGGAGGAAGATCCTGGCAACGAGAGCTCGTCTTCCTCATCCTCGTCTTCCTCTTCGTCGTCTTC
TTCTTCTTCGTCTTCTTCGTCAGTGTCGTCACGCTCGTCAGCGTCCAGCAGCTCATCTGACAATGACACTGGTCGTGACGACTAGACGCACAGAGCTGGT
TGGGCTTAGCAGAACCGAAAAGTTTTCGCTTAATTTTTAATGCTACTACCGTACGCGGTTCTCACAACACATTCTGCTGATCTTTCTTCACCTCACCTCG
TCACCTTCGTCAACTCTAGGCAGCTGCCTGCTTCTCTGCCCAGATATTTGCTGACTTTTGCCCCAGCTCGAACAGTCGATCCAGCACTTCAATCTGCGGT
GGGAAAAGTGCAAAGCGAGCCAATTGCATAATCGTGAACGGGAAGTCCGAGTCGATGGACGGACTGATCTCGTAGTCCTCCCGACGTAGTATGTGGGCGT
GGAAGGCGCACACCTTGGTGTATCCCGGTACTTCCGGCACCAAAGTGAGGAGACCTCCGTCCACGTGGTACTCTCCTCGAAAGACCGACGTGCCCCGCCT
CGCCAAGTACCAAGGCACATAGCACGATGCAATGAGCGCGTCGCACAGATCCTCTGTCGAGTGGAAGTCGTCGGTGAGCACCAGCGCTCTAGCCGGCCAC
ATTTTCTCCGTGGCGATCGTGAGGCGCTGCGCCAGCGTCTCCACGGGCAGGTCGCCGAACTTGGTGTGGAAGATGGCGCGCAGTCGCTCCTCGAGCTTCC
AGACGGTGCCGTGGCTATGGCAGAGTCTGGCCATGGCCTTGGTTTCCTCGAGGATGTCGCGCGTACTGGCGTTGGCAGCCAGACTCAAGGCCGCAATGGC
GCCTCCTGAAGCTCCGGCGAACTTGGAACTGGACTGGATGTATCCGGCATCCTGGAGGCCCTGCGCCACACCCAAGTGGTACGGGATCAGGAACCCGCAG
CCACTGAAGCTGAAGCTGTGCG