Description :
From Genome Similarity Track
Location :
Scaffold_746:507- 3711
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_746-snap-gene-0.4Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_746-fgenesh-gene-0.1Regulator of chromosome condensation (RCC1)

Sequence
3204 bases(100 bases per row)
ATCACGCCGTACCTGACATGCTCGCGCTGCAACAGCATCGTGTTCATCAACGCCCATCGTGTGCGGCGGAAGGAAGAACAACTCACCGGTACCGAGAAGC
CGCTGGAAGAGTACGAGCAGGTGCCGGCATGTCCAGGCTGCGGCAGCACGAGGTACCTGCGCGCAGGAGTCGTCAGCTTCCAGGGCCAAATCGAGGACAA
GAAGCGCGCGATCCGCGAGTTCGAGCGCAAGCGCGGACCAGCAACAGCGCTGATCCAGCGGGTCGCCAGGGGATTCCTCGGTCGCCTCGAGTTCCGCCGG
CGCCTGATCGAGCGCGAACGCTACCTGCGCAAGATCAACCGCGCGGCGACCCGAATCCAGACTCGCGTGCGTGGTATGCAGGCGCGGCGCTGCTCACTCA
TCGAGCGCTGCCTCCTGGTCATCAGGCGATTGGCACCATCGATTCTCAAAGCTGCTCTGGCTGCGCGTCCCGACCGCTCGCCCGTGTTCTGGTACTCCAA
TGCGGCCGAGCTGAACATCTTGTACTGGAACTACCGCGAGTTCGTGCGGCGAGCTGGCGGCAAGCCCTCGCTCATCCAAGTCGAGAAGAACATCTTGGAG
GTCACGCGGCGCATGCTGATGCGCGAGTACGAGCTCGTGAGCCGCATCCAGGCGCTCTGGCGCGGCGCGACGACGCGGCTCGTGTTCCGCGAGTTCAAGC
GACAGAAGGCGTGGTGGAACGGCATCCGCCAGTCGCCGGCAATCAAGATCCAGCGGCTGTATCGCGGCCACACGGCGCGCAAGGCGAGCCGCGCGTACAG
GGTCACGCGGCACTATTCGCACCAGATGCAAGTATACCGAGACGAAATGGCTACTCTGAGCAAACAGGAGAAGAGCCGCGCGTTCCGCGACAAGCTGTTG
CTCAAGTACCGCAGGCAGTTCCAGCTTGACGAGACGACGAGAATGATGGACCGGCAGCGCGGCAACCAGACCGAGGAGGCCCAGCGGCGGAAGCAGCAGC
AGCAGCAGCAACGCTTGGACCCCGTCTTGTCGCCGGAGACGTACGTGGGTCTGCAGTATTCGCTGGGGAATAGCGATGGAGCCCGATCACCTGGCGGGAA
CCTTGCGGATCTATCTAACACACCGGTCCGGCAGCGAAACCCGAACGCTCAGCGGTTCGCGCGACTCAAGCAACAGCTCGACACAAAGAAGGAGCGCGCG
CGTGGACCGCGCATCCACATCCTCAAGGCGCGGCAGTACGCGCCGGCGCCGCCGTCTCCGCTCGCGGCGTCCACTTCCGATCGCGAATGACAAGTGTAGC
CATGCAGTTCAACATGAGGATTATCGTGAGCGTTGCAATTATACGGCCGTCCCCGTATTCGAGTCGTAACTGTACACAGATATAGAAATGGGTTTCTAAA
CTTTTCGAGTGGGTCGATCCGAAGTGCTCCATTCGCATTCACCAGTTCGCGTTGACGTTAGTGGCGCTAAGCACCAGCACGACAGCGGCAGTCAGGCACG
GAAACATGACTCAGGGAGCGGCGGTCGACTGCTCGGCCGAGCAGCGCGCCGTGATGGCGTTCGGGTGCAACGACGACGGGCAGCTCGGGTCGGGCGAGCG
GCGCCACCCGTCGATCGCGATCGACGCCGTCTCGTCGGCCAACTTCCCGGCGCCGCTCGCCGCGCTGCACGGCCTGGATGTCGCGGCCATTTCGTGCGGC
TCGCGCCACACCATGGTGCTCACGACCGCCGGCGAGGTCTATTCGTTCGGTTGGGGATCGGTACGTCAGACGATCGCTTTTTGGCTTGGACGCGCAGCTC
ATCTGGTGGACCACAGATGGGACAGCTCGGTCACGGCGACCTCAAGAGCTGCAGCACGCCCAAGAAGATCGAGTTTTTCGAGCAGCAGGGGCTGGTCGTC
GACTACATTTCTTGTGGCGGGTGCCACTCCGCCGCGGTCACTCGAGACGGTACACTGGATAGTTTCTGGATGACGACGGTGTGGATGGCAGGCACTCAAT
GTGTCGTTGCGTTCCCTCGGCAGGTGTTGTCTACACGTGGGGTGAGGCCCACTGGAGCCAGCTCGGTCTCCCGAAGGAGTACACGGCGGCTTACCAGCAA
CTGCCGGCCAAGTGTCCCGTCATCCCGGCCGACAGCAACGAGAAGATTGTCAAGATCAGCTGTGGTATGAATGAGACTTGAGGTGGACTCTATTGGCAGC
ACGGGAGTGTGACCGCGTGACTTGATGCTGAGCAGGCGGATCGCACACGGCGGCGCTGAGCGACCAGGGCCGCGTGTACATGTGGGGTCGCTGCGATAGC
GGTCAGCTCGGGATCGGCGAAAAGTGGCTGCAGGAGTCGGACGACGAAGGACTGATGGGAGTGAGCCAGCCGCACCTCGTGGACGGCTTTGACGGCGAAA
AGGTGGTGCAAGTCGCGTGCGGCGCCTTCCACTCGGCGGCCATCACGGAGGCCGGCAACGTGTACATCTGGGGCAAGGAGGACTACGGGATGCTCGGCGT
TGGCCACACATCGGACTTGCAGACGCCGACGCGGATCGCGCTCTTCGAGACGGTGCCAGCTCTGTACGACTGAGGTTTCGCATCGAGTATGCGCTTCATA
GACTGACAGTGGGTGTATTCGTGTGGCGGAATAGGCGCGTGTCGTGCGGAGGGTGGCACACGATGGTGGTCGCCAAGTCTGGCGCGTGCTACGCGTTCGG
TCGCGGCGAGTACGGTCGCCTCGGGCTCGGCAACACCAAGAGCCGGACGCATCCGCACCTGGTGAGCTGCTCAGTGATTATGTGGCTGTCGACCATCTCT
AACTGAATGTTCGTCTTGTTACCTACCGACAGGTGGAGGCGTTGAAGGGCAAAACCGTGGTGCAGGCTGCGTGCGGCGGCTCGCACACGCTCTTCGTCAC
CAGCGACGGCCACGCGTACGCTGCCGGCCGTTCCGAGTACGTCGATTCTGTGTGTATTGGCTGCGGTGCTGCGATACTGACTGTCGATGTACTGTGTGGA
CTATGCAGCCACGGCCGCCTTGGACTGCAGGTCGTGAAGGCGTCGTTGGTGCCGATGCCAGTCGACCTCGGTGCTCTCCCAGTGCGGCAGGTGTCGGCGG
GCGGCGCTCATTCGTTCGCGCTGCTGCACGCGTCGCGTCCGCTGTTCTCGCCCATGATCGCTCCGATCCAGAGTGACGCCGCCGTGCCACCGCGCGAGCT
GTGA