Description :
From Genome Similarity Track
Location :
Scaffold_558:507- 3370
Transcript NameFunction/comments
Phyag_g6611hypothetical protein PHYSODRAFT_470921
Phyag_g6612hypothetical protein PHYSODRAFT_349344

Sequence
2863 bases(100 bases per row)
ATGTCGACCCGTGAACTCGGTACCGAGGGTCTCGTCCTCTCCACTGTGAGCCTACacatcgacaacatcgtCCCCCACAACTCGATCACCTCCATCGAAG
CTCAGAAAGCAGCGATCGAATCCAAACCGACAAATGAAAGCCCCCAGCAGCGCCCCACACTCAGTGCTCAAGATTCGTGGGCGCTGTTGCAGACCAAAGA
TCGCATGCAGTGGATGGAGCACTTTACGCACAACAAGCGCGGCGGTTTGCTGTTCCAGGACCGAGAGACGCTTAAGAAGCAACAAGGGGTTTTCAAGGAG
GTCATGATGCAGGTCGGATCGCAACTTTTGTCGGGAAAGCTGGCGGTACGAATCTCACTGCCGATTCGCATTTTCGAGCCCCGATCGCTGCTCGAACGTG
TGGCAAACGGGTGGAACTACGCTCCGacggtgctcaagaaggcaGCACTAAGTGGTGCTGACCCCATCGAGCGCATGAAGTTCGTGATGGCATTTGTGGC
GGGTGGTTTACACTTCTGTGTCGGTCAGCTGAAGCCATTCAACCCCATTCTAGGAGAGACCTACGAGGCTACGTACGCTGATGGGACACAAGTCTTCATG
GAGCATGTTGGTCACCACCCCGTCAAGTCTGCATTCACCGTTGTCGGCCCTAAAGGGCTCTACCGAATGTCCGGCGTATATGAGTTCGAGTCGGTCTCGA
CTCGTAATTCCCTTGCCAACTACCAGAACGGAACTGTGACGGTCTTATTCCACGACGGTGTGGTCATTACGTACACAATGCCACAGATCAAGATGAGTGG
CATCTTGTTTGGAGACCGAGTTGTAGAGATTGGGGGATCGTCCAAGTTTGAAGACATCAAGAACCACCTCGTGGGGGAGCTCAACTTTGACGCGAACAAC
AGTTTCCTGAAGAAATCGCAAAGCGATGACATCAAGGGCTGCATCTATCCAGCAACGGTGAGAATGGGTTGTTCACCGGCACATATTGTAACTACATGGG
GCTAACTCGTGTTTGTGTATTATTCTGTCTGCTCTCAGAAATCTGCTAAGCACGCGGTGGCGACTGTGAACGGTTCGTGGTTGTCACACCTTCAGTTCGA
CGGCAAGACGTAAGTGAAAGGGACAGCGTTGACGAGCATTAATACTGAAAGCGCTGACTAACACGGATTTGTTGTGACAGCTACTGGCATGTCGAATCCG
AACCCGTGTTTGAACACACACCCGTTGAAAACCCACTCCCTTCAGACGTTCGTTATCGAGAGGATATCATCGCCCTGAAGGTTGGTGGCAAATATCTTGC
TCACTGCAATTGGGAGGTACCGATTGCTAACTGTTGCTGTGCTACAGAACGGTGACGAAGCAATGGCACAATCCGAAAAGCTGCGACTCGAAGCTGTGCA
GCGAGCAGATATCAAAGCGCGACAGCTGAAGTCAGAAAAGGCCTGAAGTATTTAGCAAACTCGTCCAGTTCAGTGCATATACACGTCTCCAGCAAACGTT
CTGAAAACTCTCTATTCTGATGCGATAATAGCAGTATATGCAAGATTGGGCTGGAATCTCTCTCCTCGATCCAAATCGGGTCACCTACTAGAGTCGTGAT
CACAGCAGCACCGGTCCTCGCCCTTTGCTGTTTCACCACCCGGTTGGTTGTATGCTAGAAGCAAGTGACACTCtacttctgcttcttgagcttcttctcg
tcctcctcagcGGCGTGTTGCTGGGCGAACTGCTCGATGCACGAAATGGCAAAGTAGGCGATGAAGGCTACCATGACCCACGAGCCCAGCTGGGAAACCA
GACTGCCGCTCGaagccgccgtcgccgtgCCCGcgtgttctgcagcagccttgaCCTGTGCCGAGTGGAACTTCTCACGGCATTCAAGCAGGAACTCACT
AACCCGGGTGCCAAGTCCCCACTCCTCAGGGGTGACGCGTCCAATGAACGCCTCCACTCTCTTAAGGTGCGCGTCCGTGAAgatggtgatgaagaacgcg
GCCTGCATGTTCACCTTGATGAGAGCCTTGCCGATGAGCGTGGCGCCGAAGAAGGTCCAGAAGGGCATGAGGAAGTGGCCGCAACAAATACCGCACAGAT
CAAAGGCCATATTGGGCCAAGCCGACATGAGCAGCACGCCCCAGAAGCCGTGCTTCTCCAGGAAGCGGATCATCCAGTCCTTCATGCTGTTCATGAGGTT
GTACTGGGACTTGGACTCGGCGATCTCCTCGAACTCTTCGTTGCGTTGTCCGGCCAGTTTGGCGGCGCGACTGAGCGCATAAGGAGGGATCTCCCCCGCT
GCAGTGCCCGCGCCCCAGAGCATACAGGGCAGGAAAACCTTCcagaagatggcggcgaACGTGACGGTGGACTCGTCAGGGACCTTGTTGCAGTTGGCTT
CAAAAGGGTGGAACCACATGTGGTGGCGACTGTCGAAGTCCAAGGACCTACACTCCTGCGCCCCCTGCACCACGAGGAAAATGTGcgggaagaggaagag
gatgcCCGAGTGCATGCCCGTGCCCAGCCCCACGCTCGAGAGCACGCCCAGACCGACCCACCAGACCACGAACTTGACGCTctcgttgaactcgtccagc
agctggcGGTGTGGCCCGTCGCGGCTTGAAGCCcccagccacagcagcagcagaggcagcagcacgaagcgcgtggccgaaCTGCGCTGCACTCGGAGCG
CCAGCCACGAGAGGAAGCGCACGAGCACGATGCTGAAGTGGTACAGCACGCTGAAAGGGCGGCGGAACAgcgtcagcttcttgcgctcctgGCGCAGCTG
CTCGGccagcgcggcggcggcggcgtcgtcttcggtgCTCGCCATGGTCTCcgctcgccttct