Description :
From Genome Similarity Track
Location :
Scaffold_51:50687- 53516
Transcript NameFunction/comments
Phyin_T30-4PITG_16649Chromosome transmission fidelity protein%2C putative

Sequence
2829 bases(100 bases per row)
CGTGGCTGGTTGCGAGCTTATCTCCCAACATCCGCCGTATCAACCCGTCGCTTCAGACTAAGGAAGAGAAACTGATGATTCAGCGACTTATTCAGTTGAT
GGCGTCACTGGGACTGTCATTCCGTCACAAATATCGACCAGATGGAAGCGAAGACTACGCACTCGAGCCGTACGTTTTCTTTTTTTGGTGAAGCATTTGG
TTATTTCACTTTTTTTTCTTATCACGCTGTTGTCGTGTCTGGACAGGGCGCTGAATGAACTGGTGGAGTTCCGAAGTAGAGAAGGTGGCACACCGTATCA
ATACATGCTTCCGATATCGGTGCGGAAGATGATAGCTCGCGAGGTGGAGCTGGAGCAGATGCGTCGGAATGAAAAATCGTCTCCGTCCGTTAAGCAAAAC
AACAGTAAGTCGCCTGCAGTGGCAGTCGACAAATCCAGCGAAGCTACCATCGAAGAGAAGGCTGCAAAGGCCGCCTACGTTCTGCCTGAGCTCAGCGGTA
AGTGTTTGAGTCGGTTGCAGAGATCTACATCTTATTCACTCAATGGCTGTGTGAACTGCAGATGTGGAGCTGGTGAAGAAGGACGAGGCTCTGCGTAAGC
GTAACCCCTTCGCATTCGCTCACCGCGAGGCCAAACGAAAACGCGACGAGGAGTTGAACGCAAAGCTCAAGCTACAGCGCACAAACGATGCGCACAAGCA
CTCCAGGGTGCACTACAAGTTTAACGAAGGCTACACATGCGGTATCAAGACAGCCGTGTACATCAGTGATTTATTATGAAACCACTGATCGGCCGACTGT
ATTGCAAGTTAAAAGCTCTCTTCTAGCCTTACTGAGTCAACTACATCTTTACTTCTTCCCCTTCTTTTTCTTCTTGTCCGTTTGGCTTGCGAGTACCGGT
GCATCGGGGTAGTTCTGGGTGGGCGACAATGGCGTCGTCGACGGCGGCAGCGTCTTCATGGGCCCAAGCACCTCTTACAATACGAAGCGCAGTAGCCTCG
TTAGTCGGAACAGGTTCGTCGTGTCCGTCGTGGTGTATTTGACCACCCCAACGCGTCCGGCGACACTACGAGGTGAAGCGTTGGCAACGTGGTGCGACAC
CCGCGACACCCGCGCCACCACCTTCACGTCCTTCTTGGCCGTCGCACGCGTCTTGAGGAAGAAGCGCGAGTTTAGGGGATCCCCCACGAAATCCAACTTC
GTCTGCTCCTCGAAGCGCTCCCAGATCACATTACCATTGCCCACCATCGTTGCTTGGATGGGCACCTTCCGAGATGCAATCTCACCGGTATGGTGCTTTT
ATGTCTAAATGCTGATGTGCTCTGTCGACGTCCGGTGTATTCGAAGATTTACGAATGGCGTTAGTGCACCCTTAACTACAACAACACGACAGGCTTGGAG
CACCTTTAAGCCACTTGGGCGCCCTTAACTGCAAGCGTTAGGGCGCCCTAAAGCCTTGGGCGCCCTTATCGTTAAGAATAAATAACCGTATTTTAAAAAA
TTGAGGCGAAGTATCACCATTGTCAATCTTGTCGGAGATAAAGAAACATATTAACACATTGCGTTAAGAAGAAAGCACAAGTAGGAAAGGGAAAGTGATA
TAATATATATTGTTTAGCAAAACCACGAATGGCTACAAGATTAATGTGGAAGCAGCATCTTACTAACCTATTGGTCCGTCTTCTGCATTTCCGTCAAATT
CTTCTCACTGTGTGGCACCAGCTTCGTCGTGCACAGCAACAACCAGGCTAGTCTAAGCCGCATCACGCTTACATAAGCTTCTGTCAACCGACGGCGTTCA
AATCGATGGGTGTTGCGCAAGTGTGCGTACACAATGCCCAGGACCATTACTCTACAGCTTTTTAAATCAGGTTGTGAGGGCTTGGCGATTAACTTCGCAA
TAATTTCTTTAGGAAAAAGCTTATTTGCACCGCAGGCACTGTGCCATTTCTCCAGGTATGGCAACAAATTAAATTTCCATGCATCTTCCAGTTCTTTTTG
TTAGCACTCCTGGTGTAGCGGCTTATAAAAATACACCTTCAGTGTTGTCGGAAACGCGATCTCCACAATAATGGCCCCCCAGCGGTTCGAGCTTAAATTA
ATGGGCATATTTACTTTAAGGTGTCTCTGATAATCACTATCTTGGTGGTTCAGGCCACCCAGTAGCCAATGTCAACGAAGAAAATACGATGCAGCCGTCC
ACACGTTCTGCAATCATTCTGATTCCGAAATCAATCATGGCGTCGTTCAGCAATCCGTTGCGTAGAACTCCAGAGACAACATAAAAAAAATACGATGGCC
GTCGTGTTGATTCTGCATTTGCGACAGATCTCGTCGTGAAAGTGGCGCGTCTTAAAGACACGTGAGAAGGGAATTCATATACTTATTAAAATGGAGAGTT
ATACGTAAAAATGTAGTGTAACTTTACCTATCTCGTGGAGTATGCATCTAGCGCCTCACTTGAATCGCTTGCGTAGTCGAGGTCTTCGTCACTGTCATCG
TTACCAGAGGAGGAACAAACGTCCAGCACAGTGACGCCGGGCGTGCCCTCGCTCTCGTCATCTTTAGCACGGCACAGGCGAGCGCTAAAGAACTCGTACG
TAGATTTTTAAATGATCGCAACAAAACCACTGGCTATCGGACTCGGAATTATCTGAGAGTAACGGTACTCGATGGTAATTTATTTGGGAATATATTTCTC
GTGGAATTTTTCACAAAACCTAAATTTTGAGAAAATATTGTTGCCCCCTTTTTCGGTACTTTTTATGAAAAAAGTTTAGGGTGCACTAACGACTACGAAG
ATTTACACCTCGACATCCAGAAAATGCAA