Description :
From Genome Similarity Track
Location :
Scaffold_18:506840- 512587
Transcript NameFunction/comments
Phyca_LT153461815Hypothetical protein
Phyca_LT1534110442flagellar biosynthesis regulator FlhF
Phyca_LT153459076ZYBA0S04-07294g1_1

Sequence
5747 bases(100 bases per row)
tcgatccaccgatgcgacgcacatgatcaccgtcagagagactcccgccgagatgtcctccgccttcgcaaactcgcgaagctccttcacggagacgaac
acattcgccgtctcctcggcggcttggttgcgaagttgagcgtcgacctctgccatcagctcgacggcatcttgggcacatccaagttctcctcttggca
tcgtgcagcttgggcggtgcgtgttcgcaggcgaggtgttgctggggaagcggcgagtgttcccaagagggaaaattggataatggcgtggctggttctt
ccccggcagcgaaccgttctcgctgaaaagctcgactccagcctctatgcaattaaataaacagccaaaccaaacgatgcgcttagctgcaggacttcac
cagcatgtcctcaacaccgtacgttaagtctccaacgttgcgagctgaagaccgtctcattgctggatctgcacggcctcgaagtagctacctcggtagc
cgcaccatcgccgccacatcctggacacttccgcccgctcacgtgtatctgccttggtcagggatgctgctctgtgttgccgctcagcgctaccagctca
ccccgacgacttcttactggtctttttacgccgcactaaatctaacaggtttttacccctaattaagggtgttaaggcgacagagaacagccgcacgtga
ctccaaaaatcgcctttttagctctattcgggggctacgacgctgaagcgtcgttttcctgtttactaaaaataacccctcagtttaatgactttgtgtc
gttttatttttggaggcgtcgcttcagcacgtttataattcagcccatctcacctccaaagaaagaacaaaatgttgctaaaacnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnggagcctttttttagc
tcctaggtgtgcttttctaaaagctcaccctaacccatttgcaaaactaatgcatccatctggtaaaaactaaaatagagtgtaaaatggagtgtaaata
cgagtagagtaataagagtagtgtacaccacatcaaagacttacgattatagggggggcttcgccccaattaactgacggggggaggggttgtattgagc
cagtgcaaaggtcgttttttttcggaatttgaaggacacgtgtcctacaaactttgccaccatggcgaacgtcaactggagtcatctggagaagaaagtg
gcgaagattaagcgcaacacggtgagcacgagctgtgtaccaaaactcctacggtcgattgttgcctgggttgtcctccacaaaccctaactactgatac
ctgccttcgctcagcgtctaggtaacgtatcggatctctcaatcaaacagctcaggaagcggctgaagactcatctaaacctagatgaggctgaccctcc
tcttcagtttgatgtactaaagtcagacgtctttgaggcttggctattaacgctggagaagcgcgacggtagccctcttagcttctcggcgctaaacatt
catcgcgccggtctattcaacctttatcgtgactatggatgtgagatgtctgcagctatggagaaatatttgcgccagtattttaagaggttcaaacgtg
aaatggctactgtagcagcgcgaggagaagctcgtgcaaaacgtggcaaggacccactttcttttgagctatatatttttttctgtgggcagctcctcca
acaaacatcaaaggacatgctatttgcaaaggcgtacatggaaatttcttggaatctcatgtgtcgatctgcaaacgcttttggcattcgccacgggcac
atggagtggagtggagatgccctatgtgtgtactttgcacaccagaaaaacgaccacgaaggccgtagacctcgggacccaagacgcatctacgccaatc
cattacgaccggctatctgtcccgtgctagctttggcaatattttgggctacctcgtcattcgatggctctgatcgcttatttcctggtagtaaccagta
tgtatggtttcgcaaatgtctacagcggcttttagatcgtagttgcgtggctgagaaactttatcgacgtggagttgaccgcgtcgagcttggtacgcat
tcaatgcgtaagggtgcggcaacgtattgtgcgtctggctcaacggcatgtccgccatcgacagcagttcacctccgtgctggatggccgttgggagggg
tacagaatacctatcttcaatacaagtcagtgggggacatgcatgttggccgaactgtgtcaggtctcaaccagacagtcacgaattcacagtactgcca
ccatattgagaagaacgagatgcgacaattgagaacgctactaactgtgcttttcccggcatgcccgccaacctcacgtatattggagaattttgtttgg
cttcgcttgtgtaccatgagccgtatatacgcctaaatatccccaaaaaccaccctgttttcgagtcaccgttgtttcagcacccaacgttactatcgga
tcttttggctaaattgcgtggtataaaagatcatagtgaccggcttcatgctacaggtgtgccaccgcatgtagccattttaggcgagatgaaaggttta
ttagaggctacgatcccatctttcttctggggtggacgattccgccgagtaccgcaggagtttcagcttccagactgttctgtggcgacactgtggataa
agtggcagtgtggaaacgcgacaaagaagatccctccactgcgtatgctcgatggtctggacatgccgaatagaaaaggcttagtgacattcgctacctt
atgagcagtgtgaggccgaagaagtacgacgtatcggtatgtggcgagctcgtcagaatgtagaagaagctgtgaagacattctccgcatgtgcaagcgt
cgttgctgtacctcaaagaaccacaagcgacgtcaaggtcagctcagctggaaaacggtggtggcgttgatgcgcagacgccggaagtagtagtggatga
ttggttattttttgtgttaaccacttcacggcattggtagaaataaggttattttcatgtcctgcgtttgtcctgcaaatccgtctaacaagcattttca
ctgtcagttcggtgaggcgggtgcggctgaaacatgtggctctaggttaagctacaaagtcgacccccccccccccaaaaaaacacttagtagcattttt
aaaaaaggagaatccaattttgggcaccgcttcttccatgttttcaatgaggcgggcgctgctgcgacatgtgctagcctatcaaaacaaagctagacat
gttcacactgctttctccctatcaaagcaaagcgacccttagcttaagcttgagccaaaggaagcacgtattttcacacgcatcacgagaagagattgat
agtaacttgactcttagtaatagtgaagtaccgacttccctgggttatagtgggcacttgcttataacggcggccaatcaaatctcttcaaattgagcgc
actggcttataacttccgccacaaacatttcagtgcaaaaataccggtactagaaaaagtttgagccaagcctgccactcatttcttctctgcaggcgtg
ctcacaaggtgtatgcagaactagagatcgtaaaatgggttaacgaccttaaaaaagagggggtgcctatttcgtctctaatgctagcactcgagggcaa
ggatattgccgctgaacacggtataaaaggctttcaagcttcgtggtgctggtaacacactcgctcaaagcaaaactacgggagtgctgggtaatgaatc
ttcgcgagcagcttcgtcagcatacaccaggtaagaattttgtgcttgctacaccgagtaggaggaaggtggcagagtggatctgcgcggcgtgggacgc
cttgtcagctgagactgtcgctaatgactacaaaaaggcttggtactctcctcaacaagaccgatattgcagcagccaagctgattggtgatcttgcagc
gcactgcgctgttgatgttgcagttggtgaagtagactctgatggtgacttcggcgatgtaaaaacgactaagaatagaacgacttcatcaatgacattt
cagtcggtattgataccggttaccataatcggcatatcccatttatgttgtggtatgctgtaccgacatgtaggtccgcatagggttgtactgacttcga
tttggtattgttccctcctcaaagctcatgcgaggcccgagacggtatccccgacgaaacgttttctcgatcacctgcaaaacgggccggatctggtacg
ccttgtcagtggttgtgcctccgctgttgggacttgtaaaatggaggaagcgtgttatcgttcggaatttcttgcgcttcatgtaccgtccaaaggtacc
ccgaggaacagctccatcttcactgactgtccaatgcttcgacaagccatccgtagcgtacgggcccaccaataggccaagcgcatgcaaaatcgcgtgt
tctcgaatgggcttctgtctttcaagtttgtcgatgatgtcttctaaggcttccacagatttcttagggtcgtttgcttgggctgcaagctggcgttcac
tggtctgttgggcaatcgcaggtatgcatcttctcctataggcttcggaccccagtgcaattttcttccagagagactcaggcaaaaattaaaaaaaaat
tcaatcggcgactccgcaagagcagccgccgatttcgtggttccctatctgccgtcatacaaggcagctgcgtccagtttcaagtcagctgcgtcaagtt
aaacacagagcatgttagcttgtgagtgctcttattctgtattgcacaggcttaccgcagcggtcctcgtcatacaaaatccaccctgatctggcaagct
cctgcattgccctgtcatcttgtcaaaagccttgcatgtgtcctcaaattctgggtctgactcgacttcatccacgtattcctcttcatcactctcctgc
tcggcgaaagcacactcctcctcatcggactcgacactgcatgggaacgactcgtcactaatattgacatcgtctatatcaacggggcaaaacagattct
tagtacgaaaggcttccatgaagtcatctcgatcaaacgtatccagagtcagctcatcttcagtcttcatttcctgctcagcgtcggcatcaacatcacc
agtgcttcgatccacagtggcacgttgacgcaatgcagcaccaacaccagcatcttgttctgtagcagccacactaacagcattcacatgatacaccttg
ttcagtagcagccagactatccgcgttcactggtacaccttgttctgtagcagccgcagtagggggttccatcaatacaccttgttctgcagcagccacg
ctagcggtgttgacgcgagcaccttcttctatagctgccagactagcatcattcactggtacaccttgttctgtagcagccacactagatgttcccgcca
atacaccttagccgcactagcgggggtggcgcgagaaccttgttcatgagctaaaggctcaggctggcgccgtcggacggcagcataagccgctaatttc
ccaatcggaggcttcttcgcacgaattgaaccacttcgatggggagg